Asn Met ArgCys. Asn Met ArgCys Asn Met ArgCys Asn Met ArgCys.

Slides:

Advertisements

Similar presentations

Proteins: Structure reflects function….. Fig. 5-UN1 Amino group Carboxyl group carbon.

Advertisements

Oxalate (µmol/gFW) Itaconate (µmol/gFW) r=-0.702** Citrate (µmol/gFW) r=0.389 Isocitrate (µmol/gFW) Ascorbate (µmol/gFW) r=0.052 r=0.195 New Leaves 10.

The Chemical Nature of Enzyme Catalysis

By: Tiffany J. Simmons Pd. 6. GGTCCAATGCCCGCCAGCCTAGCTCCAGTGCTTCTAGTAGGAGGGCTGAAAGGGA GCAACTTTTCCTCCAATCCTGGAAATTCGACACAATTAGATTTG AACTC GCTGGAAATACAACACATGTTAAATCTTAAGTACAAGGGGGAAAAAATAAATCAGTTA.

Aminoácidos Unidad de las proteínas. Isómeros Clasificación Esenciales Valina (Val) Leucina (Leu) Isoleucina (Ile) Fenilalanina (Phe) Metionina (Met)

Chapter 26 Amino Acids Metabolism.

5’ C 3’ OH (free) 1’ C 5’ PO4 (free) DNA is a linear polymer of nucleotide subunits joined together by phosphodiester bonds - covalent bonds between.

Protein Synthesis Making Proteins

Protein-a chemical view A chain of amino acids folded in 3D Picture from on-line biology bookon-line biology book Peptide Protein backbone N / C terminal.

Amino Acids and Proteins 1.What is an amino acid / protein 2.Where are they found 3.Properties of the amino acids 4.How are proteins synthesized 1.Transcription.

Lectures on Computational Biology HC Lee Computational Biology Lab Center for Complex Systems & Biophysics National Central University EFSS II National.

Ensemble Results of PIM1 PIM PIM Ensemble Results of GSK3 GSK GSK GSK

It og Sundhed Thomas Nordahl Petersen, Associate Professor Center for Biological Sequence Analysis, DTU

©CMBI 2005 Why align sequences? Lots of sequences with unknown structure and function. A few sequences with known structure and function If they align,

The Mechanism of Protein Splicing: **** the movie **** Animation by Maurice W. Southworth As seen in InBase, Francine Perler, Curator.

The relative orientation observed for  helices packed on ß sheets.

Protein Structure FDSC400. Protein Functions Biological?Food?

Regents Biology Protein Synthesis Making Proteins.

You Must Know How the sequence and subcomponents of proteins determine their properties. The cellular functions of proteins. (Brief – we will come back.

Proteins. The central role of proteins in the chemistry of life Proteins have a variety of functions. Structural proteins make up the physical structure.

Methods in protein sequencing. Example Problem 1 Given an unknown peptide, UkP, determine the sequence from the following data. 1.Amino acid analysis.

Chapter 27 Amino Acids, Peptides, and Proteins. Nucleic Acids.

Gluconeogenesis By Amr S. Moustafa, M.D.; Ph.D. Assistant Prof. & Consultant, Medical Biochemistry Dept. College of Medicine, KSU

Protein Synthesis. DNA RNA Proteins (Transcription) (Translation) DNA (genetic information stored in genes) RNA (working copies of genes) Proteins (functional.

BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 4 Protein Sequence.

Digestion and Absorption Johnson Chap Jack L. Leonard 2004.

Protein Synthesis Making Proteins  Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA Bodies  Cells  DNA.

Protein Synthesis Making Proteins

Classification of Proteases

LESSON 4: Using Bioinformatics to Analyze Protein Sequences PowerPoint slides to accompany Using Bioinformatics : Genetic Research.

AP Biology Lecture #33 Translation.

February 14 Chapter 26 Amino Acid Metabolism

Learning Targets “I Can...” -State how many nucleotides make up a codon. -Use a codon chart to find the corresponding amino acid.

Welcome Back! February 27, 2012 Sit in any seat for today. You will have assigned seats tomorrow Were you absent before the break? Plan on coming to tutorial.

AP Biology Warmup 11/12 Differentiate a codon and an anitcodon. Which do you use to read the following chart?

intro-VIRUSES Virus NamePDB ID HUMAN PAPILLOMAVIRUS 161DZL BACTERIOPHAGE GA1GAV L-A virus1M1C SATELLITE PANICUM MOSAIC VIRUS1STM SATELLITE TOBACCO NECROSIS2BUK.

RNA and Protein Synthesis Ribonucleic acid: another type of nucleic acid that works with DNA to make proteins.

Structural Characterization of Bacterial Levansucrase by Matrix- assisted Laser Desorption/Ionization Mass Spectrometry Hong Liu 03/23/04.

A program of ITEST (Information Technology Experiences for Students and Teachers) funded by the National Science Foundation Background Session #3 DNA &

AP Biology From Gene to Protein How Genes Work.

1 Protein synthesis How a nucleotide sequence is translated into amino acids.

Transcription and Translation

Amino Acids ©CMBI 2001 “ When you understand the amino acids, you understand everything ”

Marlou Snelleman 2011 Proteins and amino acids. Overview Proteins Primary structure Secondary structure Tertiary structure Quaternary structure Amino.

Chapter 8: From DNA to Protein Section Transcription

Proteins Structure of proteins Proteins are made of C, H, O and nitrogen and may have sulfur. The monomers of proteins are amino acids An amino acid.

Chapter 3 Proteins.

Biphasic insulin aspart 30 + metformin vs once-daily insulin glargine + glimepiride Kann P, Regulski M, Medding J, Ligthelm R A study in people with type.

GENE REGULATION Gene regulation: The ability of an organism to control which genes are transcribed in response to the environment.

Phase Bias in Niv Sabath University of Houston Overlappin enes g.

Chapter 17 How to read a table of codons. These are two forms in which you might see a table of codons.

Regents Biology Mutations Changes to DNA.

Protein Synthesis Making Proteins

Amino acids Common structure of 19 AAs H3N+H3N+ COO - R H C Proline.

COO - R group Amino group Carboxylic group L -Form Amino Acid Structure  H = Glycine CH 3 = Alanine H N 3 + H Juang RH (2004) BCbasics.

Fibrous Proteins Examples 1. a-keratins 2. Silk Fibroin 3. Collagen

Wednesday, January 16 th What is a mutation? Reminders: DNA Test Friday.

Arginine, who are you? Why so important?. Release 2015_01 of 07-Jan-15 of UniProtKB/Swiss-Prot contains sequence entries, comprising

Adapted from “Post-genome Informatics” by M Kanehisa

From gene to protein DNA mRNA protein trait nucleus cytoplasm

מחומצות גרעין לחלבונים:

Human cells stained with an antibody for the Tubulin protein

Figure 3.14A–D Protein structure (layer 1)

Amino Acids Amine group -NH2 Carboxylic group -COOH

Reading the instructions and building a protein!

class PrintOnetoTen { public static void main(String args[]) {

Chapter 18 Naturally Occurring Nitrogen-Containing Compounds

from nucleic acid language to amino acid language to PROTEIN language

Presentation transcript:

Asn Met ArgCys

Asn Met ArgCys

Asn Met ArgCys

Asn Met ArgCys

Asn Met Arg Cys

Asn Met Arg Cys

Asn Met Arg Cys

Asn Met Arg Cys

Asn Met Arg Cys

Asn Met Arg Cys Arg

Asn Met Arg Cys Arg ENSÜÜM

Asn Met Arg Cys Arg ENSÜÜM

Asn Met Arg Cys Arg ENSÜÜM

Asn Met Arg Cys Arg ENSÜÜM

Asn Met Arg Cys Arg ENSÜÜM

Asn Met Arg Cys Arg ENSÜÜM

Asn Met Cys Asn Met Arg Cys Arg ENSÜÜM

Asn Met Cys Asn Met Arg Cys Arg

Asn Met Cys Asn Met Arg Cys Arg

Asn Met Cys Asn Met Arg Cys Arg

Asn Met Arg Cys VALMIS! Valgu molekul on sünteesitud!