BY: SHERENE MINHAS. Agr Glu Thr Ile Glu Ser Leu Ser Ser Ser Glu Glu Ser Ile Pro Glu Tyr Lys Gln Lys Val Glu Lys Val Lys His Glu Asp Gln Gln Gln Gly Thr.

Slides:

Advertisements

Similar presentations

Chemistry 2100 Lecture 10.

Advertisements

Proteins: Structure reflects function….. Fig. 5-UN1 Amino group Carboxyl group carbon.

Supplementary Figure 1A

Oxalate (µmol/gFW) Itaconate (µmol/gFW) r=-0.702** Citrate (µmol/gFW) r=0.389 Isocitrate (µmol/gFW) Ascorbate (µmol/gFW) r=0.052 r=0.195 New Leaves 10.

The Chemical Nature of Enzyme Catalysis

By: Tiffany J. Simmons Pd. 6. GGTCCAATGCCCGCCAGCCTAGCTCCAGTGCTTCTAGTAGGAGGGCTGAAAGGGA GCAACTTTTCCTCCAATCCTGGAAATTCGACACAATTAGATTTG AACTC GCTGGAAATACAACACATGTTAAATCTTAAGTACAAGGGGGAAAAAATAAATCAGTTA.

A Ala Alanine Alanine is a small, hydrophobic

It og Sundhed Thomas Nordahl Petersen, Associate Professor Center for Biological Sequence Analysis, DTU Building 208, room 021

Thyroxine T 4 Jared Rubenstein. Thyroxine is a hormone secreted by the thyroid gland.

It og Sundhed Nov Jan. Thomas Nordahl Petersen, Associate Professor Center for Biological Sequence Analysis, DTU

Aminoácidos Unidad de las proteínas. Isómeros Clasificación Esenciales Valina (Val) Leucina (Leu) Isoleucina (Ile) Fenilalanina (Phe) Metionina (Met)

Chapter 26 Amino Acids Metabolism.

5’ C 3’ OH (free) 1’ C 5’ PO4 (free) DNA is a linear polymer of nucleotide subunits joined together by phosphodiester bonds - covalent bonds between.

“Discovery” of MSG … Dr. Kikunae Ikeda (1908) An attentive taster will find out something common in the complicated taste of asparagus, tomatoes, cheese.

CHMI E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Peptides - General structure and properties.

Amino Acids and Proteins 1.What is an amino acid / protein 2.Where are they found 3.Properties of the amino acids 4.How are proteins synthesized 1.Transcription.

It og Sundhed Thomas Nordahl Petersen, Associate Professor Center for Biological Sequence Analysis, DTU

FIGURE (part 2) Urea cycle and reactions that feed amino groups into the cycle. The enzymes catalyzing these reactions (named in the text) are distributed.

©CMBI 2005 Why align sequences? Lots of sequences with unknown structure and function. A few sequences with known structure and function If they align,

The relative orientation observed for  helices packed on ß sheets.

Protein Structure FDSC400. Protein Functions Biological?Food?

Proteins. The central role of proteins in the chemistry of life Proteins have a variety of functions. Structural proteins make up the physical structure.

Chapter 27 Amino Acids, Peptides, and Proteins. Nucleic Acids.

Proteins and Enzymes Nestor T. Hilvano, M.D., M.P.H. (Images Copyright Discover Biology, 5 th ed., Singh-Cundy and Cain, Textbook, 2012.)

1.What makes an enzyme specific to one type of reaction (in other words, what determines the function of a protein)? –SHAPE determines the function of.

Protein Synthesis. DNA RNA Proteins (Transcription) (Translation) DNA (genetic information stored in genes) RNA (working copies of genes) Proteins (functional.

On the nature of cavities on protein surfaces: Application to the Identification of drug-binding sites Murad Nayal, Barry Honig Columbia University, NY.

BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 4 Protein Sequence.

Digestion and Absorption Johnson Chap Jack L. Leonard 2004.

Protein turnover Catabolism of amino acids II

Classification of Proteases

LESSON 4: Using Bioinformatics to Analyze Protein Sequences PowerPoint slides to accompany Using Bioinformatics : Genetic Research.

Amino Acids & Side Groups Polar Charged ◦ ACIDIC negatively charged amino acids  ASP & GLU R group with a 2nd COOH that ionizes* above pH 7.02nd COOH.

Learning Targets “I Can...” -State how many nucleotides make up a codon. -Use a codon chart to find the corresponding amino acid.

Welcome Back! February 27, 2012 Sit in any seat for today. You will have assigned seats tomorrow Were you absent before the break? Plan on coming to tutorial.

Amino acids Met dank aan Dr. Detke.

Outline What is an amino acid / protein

A program of ITEST (Information Technology Experiences for Students and Teachers) funded by the National Science Foundation Background Session #3 DNA &

1 Protein synthesis How a nucleotide sequence is translated into amino acids.

Cell Division and Gene Expression

Amino Acids ©CMBI 2001 “ When you understand the amino acids, you understand everything ”

Marlou Snelleman 2011 Proteins and amino acids. Overview Proteins Primary structure Secondary structure Tertiary structure Quaternary structure Amino.

Proteins Structure of proteins Proteins are made of C, H, O and nitrogen and may have sulfur. The monomers of proteins are amino acids An amino acid.

©2001 Timothy G. Standish Hebrews 12:28 28Wherefore we receiving a kingdom which cannot be moved, let us have grace, whereby we may serve God acceptably.

X-ray detection xray/facilities.html.

Amino Acids  Amino Acids are the building units of proteins. Proteins are polymers of amino acids linked together by what is called “ Peptide bond” (see.

Supplementary Fig. 1 Relative concentrations of amino acids after transamination reaction catalyzed by PpACL1, α- ketoglutarate as the amino acceptor.

Chapter 17 How to read a table of codons. These are two forms in which you might see a table of codons.

Stephen Taylor i-Biology.net Photo credit: Firefly with glow, by Terry Priest on Flickr (Creative Commons)

Amino Acids and Proteins Amino Acids. L-isoleucine.

Amino acids Common structure of 19 AAs H3N+H3N+ COO - R H C Proline.

COO - R group Amino group Carboxylic group L -Form Amino Acid Structure  H = Glycine CH 3 = Alanine H N 3 + H Juang RH (2004) BCbasics.

Genomics Lecture 3 By Ms. Shumaila Azam. Proteins Proteins: large molecules composed of one or more chains of amino acids, polypeptides. Proteins are.

Arginine, who are you? Why so important?. Release 2015_01 of 07-Jan-15 of UniProtKB/Swiss-Prot contains sequence entries, comprising

Useful shell commands head/tail, cut, sort, uniq Virginie Orgogozo March 2011.

Useful shell commands head/tail, cut, sort, uniq Virginie Orgogozo March 2011.

Table 2. the contents of free amino acids

Transcription, Translation & Protein Synthesis

Collagen By: Yurani Farfan.

Cathode (attracts (+) amino acids)

Figure 3.14A–D Protein structure (layer 1)

Amino Acids Amine group -NH2 Carboxylic group -COOH

Casein By: Sherene Minhas.

How to Test an Assertion

Chapter 18 Naturally Occurring Nitrogen-Containing Compounds

Thomas Nordahl Petersen, Associate Prof, Food DTU

Fig. 3 Organization of the active site of DHHC20.

Presentation transcript:

BY: SHERENE MINHAS

Agr Glu Thr Ile Glu Ser Leu Ser Ser Ser Glu Glu Ser Ile Pro Glu Tyr Lys Gln Lys Val Glu Lys Val Lys His Glu Asp Gln Gln Gln Gly Thr Asp Gln His Gln Asp Lys Ile Tyr Pro Ser Phe Gln Pro Gln Pro Leu Ile Tyr Pro Phe Val Glu Pro Ile Pro Tyr Gly Phe Leu Pro Gln Asn Ile Leu Pro Leu Ala Gln Pro Ala Val Val Leu Pro Val Pro Gln Pro Glu Ile Met Glu Val Pro Lys Ala Lys Sap Thr Val Tyr Thr Lys Gly Arg Bal Met Pro Val Leu Lys Gln Pro Thr Ile Pro Phe Phe Asp Pro Gln Ile Pro Lys Leu Thr Asp Leu Glu Asn Leu His Leu Pro Leu Pro Leu Leu Gln Pro Ser Met Gln Gln Val Pro Gln Pro Ile Pro Gln Thr Leu Ala leu Pro Pro Gln Pro Leu Trp Ser Val Pro Glu Pro Lys Val Leu Pro Ile Pro Gln Glu Val Leu Pro Tyr Pro Val Arg Ala Val Pro Val Gln Ala Leu Leu Leu Asn Gln Glu Leu Leu Leu Asn Pro Pro His Gln Ile Tyr Pro Val Pro Glu Pro Ser Thr Thr Glx Ala Asx His Pro Ile Ser Val

“The structure is more open and fluid, perhaps a "bowl-of-spaghetti" type of model.”

Casein protein is a slow digesting protein. This protein enters the blood stream but has very little impact on protein synthesis. This is a very good muscle-sparing protein.

Professional Athletes use this protein to build muscle and get stronger. Because Casein is a milk protein any organism that drinks milks uses this protein.

 I chose this protein because I thought the name was really cool. I also have heard of this protein before so I wanted to learn more about it, so that is why I chose this protein

 What I found interesting about this protein is that is precipitated from milk from rennin. It is used to make plastics, paints and foods, it is based off of cheese.  Some experts think that Casein may have negative effects on people who have autism.

ource=hp&q=casein&um=1&ie=UTF- 8&sa=N&tab=wi protein.html tegory/casein-protein/ ract