Breaking Barriers: getting biologists involved in everyday data integration using Moby Paul Gordon Genome Canada Bioinformatics Platform University of Calgary, Canada
Outline concept, usage, future Getting Biologists Involved: Seahawk &
DNASequence NCBI_gi Sequence_Alignment
Core Moby Service Providers in Europe
Founding partner
SADI In A Nutshell
As OWL Axioms HomologousMutantImage is owl:equivalentTo { Gene Q hasImage image P Gene Q hasSequence Sequence Q Gene R hasSequence Sequence R Sequence Q similarTo Sequence R Gene R = “my gene of interest” }
Mobify the World.
Paul’s Maxims You cannot get rid of work You can: –Distribute work amongst parties with vested interests & required capabilities –Avoid redoing the same work repeatedly
Agenda Motivation Audience Mechanism
Larry Wall’s “Virtues of a Programmer” HUBRIS LAZINESSIMPATIENCE
Audience God Amoeba Taverna self-starters Willing to take training Capable but no hubris Self-perception of computer skills
Man’s Prayer I’m a man… But I can change… If I have to… I guess… Bioinformatician
Take the output of the U of C service and send it to iHOP, then send its output to DDBJ’s service…
myGRID RDF
Semantic Annotations for WSDL
bioxml.info
MOB Rule Syntax >gi| glycerol kinase cgatcagcatcgactagcatcgactatttgctatcat cagctacgatcagctacgactac…
Shared Responsibility Tu deviens responsable pour toujours de ce que tu as apprivoisé. Service Providers Proxy Provider Third Party Developers Biologists
SAWSDL Required Infrastructure Calgary (Sun v240) Calgary Anywhere Compute Cloud (e.g. Calgary or Google App Engine)
To Do Formal user studies HTML Form wrapping Enactment portal Biocatalogue? If you can not measure it, you can not improve it. – Lord Kelvin
Acknowledgements