Enrique Blanco - imim.es © 2006 Enrique Blanco (2006) A few ideas about DNA computing

Enrique Blanco - imim.es © Definition DNA computing or molecular computing can be defined as the use of biological molecules, primarily DNA (or RNA), to solve computational problems that are adapted to this new biological format

Enrique Blanco - imim.es © Bioinformatics, Biocomputing and DNA computing Bioinformatics: Data mining on biological (sequence) data Biocomputing: Design of algorithms based on evolutionary laws such as selection or mutation events DNA computing: Use biochemical processes based on DNA to solve mathematical problems

Enrique Blanco - imim.es © Computers Vs DNA computing (I) GATCGACTAC

Enrique Blanco - imim.es © Computers Vs DNA computing (II) DNA-based computersMicrochip-based computers Slow at single operationsFast at single operations (fast CPUs) Able to simultaneously perform billions of ops Can do substantially fewer ops simultaneously Huge storage capacitySmaller capacity Require considerable preparations before Immediate set up Chemical deterioration (copy errors) Vulnerable, easy back up

Enrique Blanco - imim.es © Why do we investigate about “other” computers? Certain types of problems (learning, pattern recognition, fault- tolerant system, large set searches, cost optimization) are intrinsically very difficult to solve with current computers and algorithms NP problems: We do not know any algorithm that solves them in a polynomial time  all of the current solutions run in a amount of time proportional to an exponential function of the size of the problem Exponential cost can be approached by massive paralellism  an exponential amount of processors running in parallel could get it

Enrique Blanco - imim.es © Massive parallel machines (potential) x molecules/mole Massive parallel searches: Desktop PC: 10 9 ops/sec Supercomputer: ops/sec 1 µmol of DNA: reactions

Enrique Blanco - imim.es © Advantages of DNA computing: Storage capacity: 1 bit per cubic nanometer (1 gm of DNA = 1 billion CDs) Massive production of DNA molecules with specific properties Great energetic efficiency (with 1 Joule, +10 magnitude orders better) Natural chemical interactions between DNA molecules, according to defined rules to produce new molecules Well known lab techniques for the isolation/identification of product molecules with specific properties: PCR, ligation, gel electrophoresis,...

Enrique Blanco - imim.es © DNA memory: A DNA string can be viewed as a memory resource to save info: 4 types of units (A,C,G,T)  numbers in base 4 Complementary units: A-T,C-G Double-stranded strings ATGGATCAGCTGA TACCTAGTCGACT

Enrique Blanco - imim.es © DNA operators: Lab technology Hybridization Ligation Polymerase Chain Reaction (PCR) Gel Electrophoresis Affinity Separation Restriction Enzymes

Enrique Blanco - imim.es © Hybridization and ligation Base-pairing between 2 complementary single-strand molecules to form a double stranded DNA molecule + Joining DNA molecules together

Enrique Blanco - imim.es © PCR Amplify (identical copies) of selected double stranded DNA molecules  2 n copies/step

Enrique Blanco - imim.es © Gel electrophoresis Molecular size fraction technique: detection of specific DNA

Enrique Blanco - imim.es © Affinity Separation An iron bead is attached to a fragment complementary to a substring A magnetic field is the used to pull out all of the DNA fragments containing such a sequence

Enrique Blanco - imim.es © Restriction enzymes Cut the DNA at a specific sequence site

Enrique Blanco - imim.es © An example of NP-problem: the Traveling Salesman Problem A hamiltonian path in a graph is a path visiting each node only once, starting and ending at a given locations

Enrique Blanco - imim.es © An example of NP-problem: the Traveling Salesman Problem (II) TSP: A salesman must go from the city A to the city Z, visiting other cities in the meantime. Some of the cities are linked by plane. Is it any path from A to Z only visiting each city once? A=ATLANTA  Z=DETROIT, YES A=BOSTON  Z=DETROIT, NO

Enrique Blanco - imim.es © An example of NP-problem: the Traveling Salesman Problem (III) 1.Code each city (node) as an 8 unit DNA string 2.Code each permitted link with 8 unit DNA strings 3.Generate random paths between N cities (exponential) 4.Identify the paths starting at A and ending at Z 5.Keep only the correct paths (size, hamiltonian)

Enrique Blanco - imim.es © Coding the paths Atlanta – Boston: ACTTGCAGTCGGACTG |||||||| CGTCAGCC R: (GCAGTCGG) (A+B)+Chicago: ACTTGCAGTCGGACTGGGCTATGT |||||||| TGACCCGA R: (ACTGGGCT) Solution A+B+C+D: ACTTGCAGTCGGACTGGGCTATGTCCGAGCAA Hybridization and ligation between city molecules and intercity link molecules

Enrique Blanco - imim.es © Filter the correct solutions 1.Identify the paths starting at A and ending at Z PCR for identifying sequences starting with the last nucleotides of A and ending at the first nucleotides of Z 2. Keep only the paths with N cities (N=number of cities) Gel electrophoresis 3. Keep only those paths with all of the cities (once) Antibody bead separation with each vertex (city) The sequences passing all of the steps are the solutions

Enrique Blanco - imim.es © Other classical problems already approached The SAT problem (satisfactibility of boolean clauses) Breaking the Data Encription Standard (DES) The maximum clique problem The knights problem (RNA) DNA computers for general purpose?

Enrique Blanco - imim.es © 2006 References DNA computing (web): L.M. Adleman, "Molecular Computation of Solutions to Combinatorial Problems", Science 266: , 1994Science 266: , 1994 Y. Benenson, T. Paz-Elizur, R. Adar, E. Keinan, Z. Livneh, and E. Shapiro, "Programmable and autonomous computing machine made of biomoleculres", Nature 414: , 2001Nature 414: , 2001 Byoung-Tak Zhang. Molecular Computing: An Overview. BiointelligenceLaboratory. School of Computer Science and Engineering,Seoul National University March 13, 2002.