Molecular Phylogeny course: Sequence Information Students: Razick Ahmed Sabry Mehio Wissam Lydakis Apostolos Sathyanara Tejashwari.

Slides:



Advertisements
Similar presentations
LG 4 Outline Evolutionary Relationships and Classification
Advertisements

EVIDENCE OF EVOLUTION.
Phylogenetic Tree A Phylogeny (Phylogenetic tree) or Evolutionary tree represents the evolutionary relationships among a set of organisms or groups of.
By: Valerie Scheirer, Tim Davis, and Aleksandra Kumor.
Phylogenetic Trees Systematics, the scientific study of the diversity of organisms, reveals the evolutionary relationships between organisms. Taxonomy,
Phylogenetics - Distance-Based Methods CIS 667 March 11, 2204.
Phylogenetic reconstruction
Human Evolution – The rise of Homo sapiens Where to Begin? Right Now! The genetic analysis shown indicates that human ancestors migrated out of Africa.
Human Evolution.
5.4 Cladistics Nature of science:
Chapter 2 Opener How do we classify organisms?. Figure 2.1 Tracing the path of evolution to Homo sapiens from the universal ancestor of all life.
Classification and Phylogenies Taxonomic categories and taxa Inferring phylogenies –The similarity vs. shared derived character states –Homoplasy –Maximum.
How is the amino acid sequence determined?
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
 Fossil: Any non-living object obtained from the ground indicating the former presence of a living thing in a broad sense is a FOSSIL  Rock strata can.
Molecular Clock. Rate of evolution of DNA is constant over time and across lineages Resolve history of species –Timing of events –Relationship of species.
Classification and Systematics Tracing phylogeny is one of the main goals of systematics, the study of biological diversity in an evolutionary context.
PROLOGUE READ P.1-17 HW  C&C P.6, #2,4 C&C P.14, #2,3,4,5 C&C P.17, #1,2 (*WRITE QUESTION W/ANSWER*)
 Fossils provide an objective record of Evolution Fossil = A preserved or mineralized remains (bone- petrified tree – tooth – shell) or imprint of an.
Phylogeny: Evolutionary History and Ancestry Background © 2008 Regents of the University of California. All rights reserved. Use for SGI Field Test only.
Are birds more closely related to reptiles or mammals?
Human Evolution Also Known As…
By: Henry Cheatham, Brett Samuels, and Nicole Kottmann.
Systematics and the Phylogenetic Revolution Chapter 23.
Calculating branch lengths from distances. ABC A B C----- a b c.
Function preserves sequences Christophe Roos - MediCel ltd Similarity is a tool in understanding the information in a sequence.
UNIT 6 - Evolution SWBAT compare the relatedness of various species by applying taxonomic principles (cladistics, phylogeny, morphology and DNA.
Human Evolution Biology Notes Primates Ancient mammal ancestors of prosimians, monkeys, apes, and humans –Grasping hands and feet –Forward eye.
ARE THESE ALL BEARS? WHICH ONES ARE MORE CLOSELY RELATED?
EVOLUTION OF GROWTH HORMONE, PROLACTIN AND THEIR RECEPTORS
Microevolution Quiz  Do not write on it in the same color as you took the quiz  If you think you did well on it and it will help your grade, turn it.
Molecular Evolution. The fact that all species utilize the same genetic code to synthesize proteins argues for a common ancestry to all life on earth.
Using blast to study gene evolution – an example.
5.4 Cladistics Essential idea: The ancestry of groups of species can be deduced by comparing their base or amino acid sequences. The images above are both.
Classification.
Human Origins.
Ayesha M.Khan Spring Phylogenetic Basics 2 One central field in biology is to infer the relation between species. Do they possess a common ancestor?
Tuesday 12/15/15 Learning Goal: Describe evidence that supports the theory of evolution. Warm-up: If two organisms look very similar during their early.
Phylogeny.
Chapter 6 Section 2 Evidence of Evolution. Does natural selection occur today? YES! Cockroaches in a building…
5.4 Cladistics The images above are both cladograms. They show the statistical similarities between species based on their DNA/RNA. The cladogram on the.
Examining Genetic Similarity and Difference of the Three Progressor Groups at the First and Middle Visits Nicole Anguiano BIOL398: Bioinformatics Laboratory.
Molecular Evolution. Study of how genes and proteins evolve and how are organisms related based on their DNA sequence Molecular evolution therefore is.
Human Evolution Ch 17.6 “wolf book”. Human evolution is NOT controversial amongst most scientists BUT disagreements on: how many species. Interpretations.
Essential idea: The ancestry of groups of species can be deduced by comparing their base or amino acid sequences. By Chris Paine
Phylogeny & Systematics The study of the diversity and relationships among organisms.
5.4 Cladistics Essential idea: The ancestry of groups of species can be deduced by comparing their base or amino acid sequences. The images above are.
Section 2: Modern Systematics
5.4 Cladistics Essential idea: The ancestry of groups of species can be deduced by comparing their base or amino acid sequences. The images above are both.
Title: Different Types of Evolution
5.4 Cladistics Essential idea: The ancestry of groups of species can be deduced by comparing their base or amino acid sequences. The images above are both.
EVOLUTIONARY RELATIONSHIP BETWEEN ORGANISMS
Evidence for Evolution.
EVIDENCE OF EVOLUTION.
Section 2: Modern Systematics
Evidence of Evolution.
Multiple Alignment and Phylogenetic Trees
Biological Evidence of Evolution
Evidence of Evolution Chapter 6 Section 2.
Molecular Evolution.
Chapter 25 Phylogeny and the Tree of Life
Conservation in Evolution
6.2 Evidence of Evolution Key concepts: What evidence supports the theory of evolution? How do scientists infer evolutionary relationships among organisms?
5.4 Cladistics Essential idea: The ancestry of groups of species can be deduced by comparing their base or amino acid sequences. The images above are both.
Unit Genomic sequencing
Copyright Pearson Prentice Hall
Evidence for Evolution
18-2 Modern Evolutionary Classification
Copyright Pearson Prentice Hall
PROJECT DUE TUESDAY!.
Presentation transcript:

Molecular Phylogeny course: Sequence Information Students: Razick Ahmed Sabry Mehio Wissam Lydakis Apostolos Sathyanara Tejashwari

Introduction – Growth hormone Growth hormone (or somatotropin) is a protein hormone of about 190 amino acids Synthesized and secreted by cells called somatotrophs. A major participant in control of several complex physiologic processes, including growth and metabolism. Also of considerable interest as a drug used in both humans and animals.

Methods of Phylogeny Maximum Parsimony: Optimal tree is the one with the fewest mutations. Maximum Parsimony: Optimal tree is the one with the fewest mutations. Maximum Likelihood: Assigns probabilities to mutations. The optimal tree is the one with highest probability. Maximum Likelihood: Assigns probabilities to mutations. The optimal tree is the one with highest probability. Distance Matrix: The optimal tree is the one resulting from the least number of inter-species distance and evolution. Distance Matrix: The optimal tree is the one resulting from the least number of inter-species distance and evolution.

Approach Approach 1

Trying to prove (Approach Trying to prove (Approach 1) Evolution of pituitary growth hormone (GH) in mammals has generally been very slow but with short bursts of rapid change in the evolution of some groups. Such a period of rapid change occurred in the evolution of GH in primates or a primate ancestor and gave rise to the marked species specificity of human GH. By cloning and sequencing of GH genes from a prosimian, the slow loris (Nycticebus pygmaeus), and a New World monkey, the marmoset, (Callithrix jacchus)it has been shown that … Evolution of pituitary growth hormone (GH) in mammals has generally been very slow but with short bursts of rapid change in the evolution of some groups. Such a period of rapid change occurred in the evolution of GH in primates or a primate ancestor and gave rise to the marked species specificity of human GH. By cloning and sequencing of GH genes from a prosimian, the slow loris (Nycticebus pygmaeus), and a New World monkey, the marmoset, (Callithrix jacchus)it has been shown that … prosimian GH is similar in sequence to pig GH while marmoset GH resembles human GH

Approach Approach 1, Strategy Research already done suggests the following facts, Research already done suggests the following facts, “ The period of rapid change in sequence for GH during primate evolution occurred after the separation of lines leading to prosimians and higher primates and before divergence of lineages for New World monkeys and Old World monkeys/apes.” “ The period of rapid change in sequence for GH during primate evolution occurred after the separation of lines leading to prosimians and higher primates and before divergence of lineages for New World monkeys and Old World monkeys/apes.”

Approach Our results of Approach 1

Mammals Prosimians and higher primates New world monkey Old world monkey Human Other mammals Approach Approach 1, results suggests

Mammals Prosimians and higher primates New world monkey Old world monkey Other mammals Conclusion from Approach 1 Human

Approach Approach 2

Distance Matrix

Maximum Parsimony

Maximum Likelihood

Biological Interpretation It is obvious from the previous results that the human GH is different from that of the rabbit, pig, elephant, dog, cat, and alpaca. The trees suggest that the primates have a different GH than that of the other mammals. This hypothesis was proved by when lab experiments showed that only human and primate growth hormone have significant effects in humans, which suggests that the receptor for GH has also mutated in primates. It is obvious from the previous results that the human GH is different from that of the rabbit, pig, elephant, dog, cat, and alpaca. The trees suggest that the primates have a different GH than that of the other mammals. This hypothesis was proved by when lab experiments showed that only human and primate growth hormone have significant effects in humans, which suggests that the receptor for GH has also mutated in primates. It is noteworthy that GH tends to be similar among species that have similar looks, sizes, and body functions. It is noteworthy that GH tends to be similar among species that have similar looks, sizes, and body functions. Some studies showed that the “Slow Loris” constitutes the turning point of the evolution of GH among mammals, but the sequencing we conducted showed nothing of that, in fact the Slow Loris tended to show similarity with Some studies showed that the “Slow Loris” constitutes the turning point of the evolution of GH among mammals, but the sequencing we conducted showed nothing of that, in fact the Slow Loris tended to show similarity with

Conclusion Somewhere along the line of evolution of mammals there is a sharp mutation in GH, which led to the formation of primates. The latter evolved more and more to yield up species like chimpanzee and homo sapiens. Somewhere along the line of evolution of mammals there is a sharp mutation in GH, which led to the formation of primates. The latter evolved more and more to yield up species like chimpanzee and homo sapiens.

Macaca Back to Tree

Callithrix

Slow Loris Back to Tree