01/02/20031 Global affinity measure: GAM = aff(A i, A j )*[aff(A i, A j-1 ) + aff(A i, A j+1 ) + aff(A i-1, A j ) + aff(A i+1, A j )] Since the affinity.

Slides:

Advertisements

Similar presentations

Fast Walsh Transform Unexpected Distance One way to measure a sort of "correlation" between two Boolean functions is to compare their.

Advertisements

Unit 6 Lesson #1 Intercepts and Symmetry

Scientific Computing QR Factorization Part 2 – Algorithm to Find Eigenvalues.

D2I Project, Rome, October ARTEMIS The ARTEMIS prototype for the construction of reconciled views based on affinity evaluation and interactive.

Representing Relations Rosen 7.3. Using Matrices For finite sets we can use zero-one matrices. Elements of each set A and B must be listed in some particular.

Agglomerative Hierarchical Clustering 1. Compute a distance matrix 2. Merge the two closest clusters 3. Update the distance matrix 4. Repeat Step 2 until.

Symmetric and Skew Symmetric

Distributed Databases: Review May 2003Yangjun Chen1 Distributed Databases System Architecture Distributed Database Design Semantic Data Control Distributed.

Exercise 1- 1’ Prove that if a point B belongs to the affine / convex hull Aff/Conv (A 1, A 2, …, A k ) of points A 1, A 2,…, A k, then: Aff/Conv (A 1,

Normalized Cuts Demo Original Implementation from: Jianbo Shi Jitendra Malik Presented by: Joseph Djugash.

A Clustered Particle Swarm Algorithm for Retrieving all the Local Minima of a function C. Voglis & I. E. Lagaris Computer Science Department University.

Balanced and constant functions as seen by Hadamard = Matrix M Vector V Vector S This is number of minterms “0” in the function.

Table of Contents Matrices - Inverse Matrix Definition The inverse of matrix A is a matrix A -1 such that... and Note that... 1) For A to have an inverse,

Grammar Power 1 Important Verbs TO BE / TO HAVE.

H.Lu/HKUST L04: Physical Database Design (2)  Introduction  Index Selection  Partitioning & Denormalization.

Properties of Relations In many applications to computer science and applied mathematics, we deal with relations on a set A rather than relations from.

1 Learning with Local and Global Consistency Presented by Qiuhua Liu Duke University Machine Learning Group March 23, 2007 By Dengyong Zhou, Olivier Bousquet,

Unit Unit 04 Relations IT DisiciplineITD1111 Discrete Mathematics & Statistics STDTLP1 Unit 4 Relations.

Presented by Document Clustering on Supercomputers Yu (Cathy) Jiao, Ph.D. Applied Software Engineering Research Group Computational Sciences and Engineering.

Class 27: Question 1 TRUE or FALSE: If P is a projection matrix of the form P=A(A T A) -1 A T then P is a symmetric matrix. 1. TRUE 2. FALSE.

394C, Spring 2013 Sept 4, 2013 Tandy Warnow. DNA Sequence Evolution AAGACTT TGGACTTAAGGCCT -3 mil yrs -2 mil yrs -1 mil yrs today AGGGCATTAGCCCTAGCACTT.

NORTHERN REGION AVERAGE OER BY CLUSTER (2010) / As of Nov 2011) RA : 2010 – 19.62% NT (2011) = 20.75% RT (2011) = 19.92%

PART 10 Pattern Recognition 1. Fuzzy clustering 2. Fuzzy pattern recognition 3. Fuzzy image processing FUZZY SETS AND FUZZY LOGIC Theory and Applications.

Equivalence Relations

Regional, Sub-Regional and National Nutrition Cluster Coordination in LAC Grupo de Resiliencia Integrada de Nutrición (GRIN) October 2015 – GNC Mtg.

Mary’s Word to Mothers Luke 1:a mother’s honor Mary’s Word to Mothers Luke 1:a mother’s honor Luke 2: a mother’s mistakes.

598AGB Basics Tandy Warnow. DNA Sequence Evolution AAGACTT TGGACTTAAGGCCT -3 mil yrs -2 mil yrs -1 mil yrs today AGGGCATTAGCCCTAGCACTT AAGGCCTTGGACTT.

Mr Kangaroo: Happy New Year! Mr Eagle: Happy New Year! Mr Kangaroo: How old are you, Mr Eagle? Mr Eagle: I’m three. How about you? Mr Kangaroo: I’m nine.

= the matrix for T relative to the standard basis is a basis for R 2. B is the matrix for T relative to To find B, complete:

Reducing a Set Covering Matrix. S I T E S Cost Areas

Derivation of the 2D Rotation Matrix Changing View from Global to Local X Y X’ Y’  P Y Sin  X Cos  X’ = X Cos  + Y Sin  Y Cos  X Sin  Y’ = Y Cos.

The MOMIS project Demo - Schemata initialization.

A very brief introduction to Matrix (Section 2.7) Definitions Some properties Basic matrix operations Zero-One (Boolean) matrices.

張智星 (Roger Jang) 台大資工系多媒體檢索實驗室

Distributed Information Systems (CSCI 5533) Presentation ID: 19

Oil Spill Simulation in a Bay

Progress Report: Week 6 Alvaro Velasquez.

Representing Relations

Solutions for Fourth Quiz

Stunting prevalence among children under 3 years old: comparing the Nairobi slums with overall urban Kenya. Data from Source: Urbanization, Poverty and.

2 Digit by 2 Digit Multiplication

Matchings (Bipartite Graphs)

,..,_ -, =.. t :: ;... t---aM 0 d -...c " ss ''- !j!j ! )

מיחזור במערכת החינוך.

دور المجتمع المدني في ترشيد وتحسين كفاءة الطاقة آفاق جديدة ومتجددة...

مفهوم التربية المدنية.

Unit 1 - Understand the Role of Business in the Global Economy

IENG 362 Markov Chains.

IENG 362 Markov Chains.

Viewing and Perspective Transformations

Quadratic Forms and Objective functions with two or more variables

Strategy for the Ministry of National Defense

Vertical Fragmentation

Human Action Recognition Week 8

Affine Gap Alignment - An improved global alignment

Weiss RA NATURE 410:

Affinity Matrix Calculations

--....,,,. _,-->r 1Jl oEUKAITf INTERNATIONAL T B RA 0 D 7 I 0 N b G.

Matrix Addition

a b NHS/RA Serum IL-17FF pg/mL % Recovery n=5 SD

Distributed Database Management Systems

“Addition” of angular momenta – Chap. 15

Matchings (Bipartite Graphs)

Demander le nom de quelqu’un

PANA enabling IPsec based Access control

Half Fourier schematic.

Coronal T2 (A) and axial TI FLAIR (B), ADC (C), and T2 (D) MR images of a 21-day-old boy. Coronal T2 (A) and axial TI FLAIR (B), ADC (C), and T2 (D) MR.

Convex and Concave Functions

Coronal T2 (A) and sagittal T1 (B), axial T2 (C), and axial ADC (D and E) MR images of a 12-day-old boy. Coronal T2 (A) and sagittal T1 (B), axial T2 (C),

Presentation transcript:

01/02/20031 Global affinity measure: GAM = aff(A i, A j )*[aff(A i, A j-1 ) + aff(A i, A j+1 ) + aff(A i-1, A j ) + aff(A i+1, A j )] Since the affinity matrix is symmetric, we have GAM = 2 *aff(A i, A j )*[aff(A i, A j-1 ) + aff(A i, A j+1 )] AM = aff(A i, A j )*[aff(A i, A j-1 ) + aff(A i, A j+1 )]

01/02/20032 Global affinity measure: AM = aff(A i, A j )*[aff(A i, A j-1 ) + aff(A i, A j+1 )] = [aff(A i, A j )*aff(A i, A j-1 ) + aff(A i, A j )*aff(A i, A j+1 )] = [bond(A i, A j-1 ) + bond(A i, A j+1 )], Where bond(A x, A y ) = aff(A z, A x )*aff(A z, A y ).

01/02/20033 Relation schema: R[A 1, …, A i, …, A j, …, A k-1, A k, …, A n ] Affinity matrix: A 1, …, A i, …, A j, …, A k-1, A k, …, A n … … … … … Clustered affinity matrix: A i1, …, A il, A i, A j, A i(l+3), …, A i(k-1) A i1, …, A il, A i, A k, A j, A i(l+3), …, … ……… …… old new

01/02/20034 AM old = AM old = [bond(A is, A i(s-1) ) + bond(A is, A j(s+1) )] + bond(A i, A il ) + bond(A i, A j ) + bond(A j, A i ) + bond(A j, A i(l+3) ) + [bond(A is, A i(s-1) ) + bond(A is, A j(s+1) )] AM new = AM new = [bond(A is, A i(s-1) ) + bond(A is, A j(s+1) )] + bond(A i, A il ) + bond(A i, A k ) + bond(A k, A i ) + bond(A k, A j ) + bond(A j, A k ) + bond(A j, A i(l+3) ) + [bond(A is, A i(s-1) ) + bond(A is, A j(s+1) )] AM new AM old = 2* AM new – AM old = 2* bond(A i, A k ) + 2* bond(A j, A k ) – 2* bond(A i, A j )