Mutations Hollywood’s images of mutation. Mutations Hollywood’s images of mutation.

Slides:

Advertisements

Similar presentations

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Advertisements

Chapter 13.3 (Pgs ): Mutations

Mutations Hollywood’s images of mutation.

Section 13.3/4: “Mutations & Gene Expression” Text Pages

Mutations (p. 307) Mutations are changes in the genetic material. Mutations may be genetic mutations or chromosomal mutations.

Mutations. Now and then cells make mistakes in copying their own DNA, inserting an incorrect base or even skipping a base as a new strand is put together.

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

Chapter 9: Genetic Engineering Section 9-1: Breeding New Organisms.

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.

Mutations 3.29 Recall that mutation is a rare, random change in genetic material that can be inherited. 3.31 Understand that many mutations are harmful.

HW # 80- Make cookies for the Cookie Mutation Lab Warm up What are the different types of mutations? How are mutations related to evolution? Place your.

Mutations Chapter 12.4.

Mutations Genetic Changes.

Don’t let this happen to you!!. MUTATIONS Changes in DNA that affect genetic information.

Agenda Songs? Go over transcription/translation jokes simulation

Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.

Chromosomal Mutations When Good Meiosis Goes Bad.

8.7 Mutations TEKS 6E The student is expected to: 6E identify and illustrate changes in DNA and evaluate the significance of these changes.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

GENE REGULATION Gene regulation: The ability of an organism to control which genes are transcribed in response to the environment.

Human Genetic Mutations

Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.

MUTATIONS _______________ are changes in the genetic material. MUTATIONS mistakes REMEMBER! Mutations can happen when cells make _____________ in.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Biology Mistakes in the Genetic Machine. Terms for Section 6 Gene regulation Mutation Point mutation Frameshift mutation Mutagen.

L. COLEMAN GENE: the section of a DNA molecule that contains the recipe for one protein. NOTE: Each DNA molecule with it’s supporting structures.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)

MUTATIONS *Mutations are mistakes made in DNA. *Mutations can be caused by either naturally occurring, random events, or by factors in the environment.

Mutations  Hollywood’s images of mutation. Mutations  Actual Mutations in fruit flies.

Mutations. What Are Mutations? MUTATION = A change in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur.

Mutations (p. 307) Mutations are changes in the genetic material. Mutations may be genetic mutations or chromosomal mutations.

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

Genetic Mutation. Mutation Greatest source of genetic diversity A change in the sequence of nucleotides of a gene. Some changes to the DNA will alter.

MUTATIONS Mutations Defined: a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. 2 Types: 1)Gene Mutations:

Mutations 13.3.

Mutations 6/26/2018 SB2d.

A change in the DNA sequence that affects genetic information

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,

Mutations Add to Table of Contents – p. 14

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

A change in the DNA sequence that affects genetic information

A mutation is a change in an organism’s DNA.

Mutations Hollywood’s images of mutation.

Ch 12-4 Genetic Mutations.

Mutations Hollywood’s images of mutation.

Bellwork How do we account for the wide variety of organisms that are on the Earth?

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

DNA is composed of nucleotides

DNA: The Blueprints For Life

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to offspring of the affected individual,

Mutations 1) Gene Mutations = change in pattern of DNA bases

DNA Mutations Types & their effects.

Mutations: Changes in Genes

Presentation transcript:

Mutations Hollywood’s images of mutation

Mutations Actual Mutations in fruit flies

What is a mutation? A mutation is any change in a cell’s DNA A mutation can occur in an individual gene - results in a single changed protein - cystic fibrosis a mutation in the protein that makes a type of ion channels in cell membrane - bacterial resistance to antibiotics is an example of a beneficial gene mutation

What is a mutation continued A mutation can occur in a chromosome - a chromosome contains many genes - chromosomal mutations affect many proteins Examples: Down Syndrome Edward’s Syndrome Cri-du-Chat

What Causes Mutations? Can be caused by mutagens- a physical or chemical cause of mutation. Examples: UV light, radiation, drugs, and benzene. Mutagens are often also carcinogens – anything that causes cancer Can be natural, random events. - mutations occur in 1/100,000 DNA replications Mutations do not have to be bad (evolution)

Point Mutations A single nucleotide is altered. Can change one amino acid in a protein Example of a point mutation is a substitution Milk – Mile GGACAATCA GGACCATCA proline -valine-serine proline-glycine-serine

Frameshift Mutations A nucleotide is either inserted or deleted from a gene. -all of the triplets from the point of mutation onward will be changed

Frameshift Mutations Insertion An insertion occurs when a nucleotide is added to a gene Example: A nucleotide is inserted The fat cat ate the rat The faa tca tat eth era t -the extra nucleotide shifts all of the triplets that follow

Frameshift Mutations Deletions A deletion occurs when a nucleotide is removed from a gene. Example: A nucleotide is removed The fat cat ate the rat Thf atc ata tet her at

proline -valine-serine arginine-cysteine-stop Deletion Insertion GGACAATCA GCGACAATCA proline -valine-serine arginine-cysteine-stop Deletion GGACAATCA GGAAATCA proline -valine-serine proline-leucine

Vocabulary Mutation Mutagen Carcinogen Point mutation Frameshift mutation - insertion - deletion

Mutations Chromosomal Mutation: change in the structure or number of chromosomes in a cell; usually caused by problems during meiosis or a mutagen Mutagen: an agent that causes a DNA mutation Ex: UV, radiation…

Chromosomal Mutations Deletion: a mutation in which part of the chromosome or a sequence of DNA is missing

Chromosomal Mutations Duplication: a mutation in which part of the chromosome or a sequence of DNA is repeated

Chromosomal Mutations Inversion: a mutation in which part of the chromosome or a sequence of DNA is flipped or rotated

Chromosomal Mutations Translocation: a mutation in which part of the chromosome or a sequence of DNA is removed from one chromosome and relocated or attached to another chromosome