Center for Integrated Animal Genomics Research Experience in Molecular Biotechnology & Genomics Summer 2010 Kanwarpal S. Bakshi, Elane C. Wright 1, Caixia Yang 1, Josephat Njoka 1,Jason W. Ross 1 1 Department of Animal Science, Iowa State University, Ames, Iowa Program supported by the National Science Foundation Research Experience for Undergraduates DBI Gene Expression in microRNA-21 Inhibited GranulosaCells in the Pig Abstract Introduction Improved reproductive efficiency in agriculturally important species such as pigs is especially vital in today's world. Because maturing oocytes are transcriptionallyinactive following germinal vesicle breakdown, any changes to mRNA or protein abundance are controlled through interactions with the surrounding cumulus cells or posttranscriptional gene regulation (PTGR) (Prather et al. 2009). MicroRNAs have been found to have a heavy influence in the regulation of mRNAs and proteins in oocytes through PTGR. One miRNA of interest, microRNA-21, is thought to repress the expression of oocyte specific proteins that are involved apoptosis, such as PDCD4. Inhibition of miR-21 during porcine oocyte maturation increased gene expression for several hundred genes as determined through AffymetrixGeneChip analysis. Using the microRNA.org, database it was determined that miR-21 is predicted to interact with up to 36 of those genes. Further analysis of four genes; PPP1CB, TGFB1, CCL2, and BMPR1B, was conducted using quantitative real time PCR. The data from the RT-PCR were inconsistent with the GeneChip analysis requiring further investigation into the potential regulation of these candidate genes via miRNA-21. Oocytematuration is an intricate process that is influenced by many factors. Because transcription stops following GVBD until the four-cell stage the amount mRNA and protein in the oocyteuntil the maternal-zygotic transition is significantly influenced by interactions between the cumulus cells and PTGR. MicroRNAs are small endogenous RNA fragments approximately 22 nucleotides long (Bartel 2004). They function in down-regulating many genes through through degradation, inhibition of initiation, elongation, and termination, deadenylation, and promotion of ribosome detachment (Lewis and Steel 2010). MiR-21 has been known for its expression in many cancer lines, contributing to their ability to rapidly proliferate and resistance to apoptosis. MiR-21 has had a post transcriptional regulatory impact on programmed cell death 4 (PDCD4), which is a novel tumor repressor. Figure 1. Binding of MiR-21 to 3’-UTR of PDCD4. Objective Our objective is to identify mRNA molecules whose expression level is affected by the presence of miRNA-21. In addition, we want to determine how these genes relate to oocyte maturation and early embryo development. Our hypothesis is that cells inhibited by miR-21 will have increased expression of specific transcripts compared to non-inhibited control cells. Materials and Methods Cumulus oocyte complexes (COC) were collected and cultured in oocyte maturation media. After collection of cumulus cells from metaphase II (MII) oocytes, RNA was extracted and checked for purity using the NanoDrop or Agilent Bioanalyzer RNA nano chip. The GeneChip® 3' IVT Express Kit was used in order to determine the levels of gene expression in three type of cumulus cells: miR-21 inhibited, control, and negative control. A pool of 360 ng was used for each treatment to determine the gene expression in each of these cells. Finally, Q-PCR was used in order to analyze the gene expression of four genes: PPP1CB, TGFB1, CCL2, and BMPR1B. Three replications were done for the negative control cells, while four replications were done for the control and miR-21 inhibited cells. Reverse transcriptase was used to create cDNA, and then primers specific for teach transcript were designed to amplify cDNA and analyze gene expression. Primers: BMPR1B For- 5’- AAACGAGGTCGACATACCACCCAA -3’ BMPR1B Rev- 5’- TCCTGTTCAAGCTCTCATCCACGCA -3’ CCL2 For- 5’- AGTCACCAGCAAGTGTCCTAA -3’ CCL2 Rev- 5’- GCTTCAAGGCTTCGGAGTTTGGTT -3’ PPP1CB For- 5’- TGTGCAGATGACTGAAGCAGAGGT -3’ PPP1CB Rev- 5’- AAGATAGTTGGCCTCTGGTGGGAA -3’ TGFB1 For- 5’- CGATAGGTGGAAAGCGGCAACCAA -3’ TGFB1 Rev- 5’- AGCTCCGACGTGTTGAACAGCATA -3’ Results and Discussion Table 1. Expression levels of the genes PPP1CB, TGFB1, CCL2, and BMPR1B, along with alignment scores. The numbers in the first three columns indicate the fluorescence intensity from the gene chips. The miR-21/Cont and miR-21/NC indicate the fold increase in gene expression when comparing the miR-21 inhibited cells to those control and negative control, respectively. The alignment score indicates the theoretical binding capacity of miR-21 to the mRNA transcript. Figure 4 (a)-(d). Real Time PCR amplification plots of (a) TGFB1, (b) CCL2, (c) PPP1CB, and (d) BMPR1B. Data from each shows that the miR-21 inhibited cells have a greater cycle threshold, which indicates that their level of gene expression is reduced compared to the control cells. 4 (a) 4 (b) 4 (c)4 (d) Figure 3 (a)-(d). Relative gene expression of (a) TGFB1, (b) CCL2, (c) PPP1CB, and (d) BMPR1B shown for control, negative control, and miR-21 inhibited cumulus cells. Results are from Q- PCR. 3 (a) 3 (b) 3 (c) 3 (d) Results from the pig gene chip analysis demonstrated that miR-21 resulted in the differential expression of a number of genes. Alignment scores from microRNA.org indicated 36 genes with an alignment score ≥ 140. From the list of 36 genes, 35 of them were down-regulated, and while only one of them was up-regulated. The four genes that we choose were all down-regulated by at least 3 fold when compared to the control cells (Table 1, Figure 2). Results from the real time PCR indicated opposite findings: the relative gene expression of three of the transcript was decreased in the miRNA-21 inhibited cells compared to controls while one transcript remained unchanged. Conclusion The results from the pig gene chip analysis and Q-PCR were inconsistent. Affymetrix analysis demonstrated an increase in gene expression in the miR- 21 inhibited cells while the Q-PCR amplification demonstrated that there was a decrease in gene expression in the miR-21 inhibited cells. This confliction indicates that we cannot make a clear conclusion regarding miRNA-21 regulation of these candidate genes, although the results from Q- PCR are much more precise and represent the biological variation present in each treatment. One plausible reason for the decrease in the amount of gene expression from the Q-PCR results could be the fact that we only took the data from one time point, instead of a variety of different times. At this time point, the amount of mRNA could have been reduced as a result of a negative feedback mechanism. A time point assay should be done in order to determine the relative expression of genes at different times in response to miRNA-21 inhibition. Acknowledgements I would like to thank Dr. Jason Ross, Elane C. Wright, Dr. Ciaxia Yang, and JosephatNjoka for all of their help and support during this summer. I would also like to thank Dr. Max Rothschild, Justin Rice, and Ann Shuey for their guidance throughout this program, and the National Science Foundation (NSF) for giving me this opportunity. References Bartel DP. MicroRNAs: Genomics, biogenesis, mechanism, and function. (2004). Cell, 116, 281–297. Prather, RS., Ross, JW., Isom, SC., & Green, JA. (2009). Transcriptional, post-transcriptional and epigenetic control of porcine oocyte maturation and embryogenesis. Soc ReprodFertil Suppl., 66, 165–176. Lewis MA, Steel KP. MicroRNAs in mouse development and disease. Semin Cell Dev Biol (2010), doi: /j.semcdb Figure 2. A p icture of several cumulus oocyte com plexes. The oocyte is shown as the dark mass in the center of the complex, while the cumulus, or granulosa cells, are shown surrounding the oocyte.