Sequence Analysis. Programme 1.A Motif-based Framework for Recognizing Sequence Families Sharan, Myers 9:45-10:10am 10:10-10:40am Coffee Break 2.An HMM.

Slides:

Advertisements

Similar presentations

Transcriptional regulation and promoter analysis

Advertisements

Transcriptional regulation in Eukaryotes The regulatory elements of bacterial, yeast, and human genes.

Control of Gene Expression

Inferring Transcriptional Regulation Using Transctiptomics Carsten O. Daub September 1 st, 2014 StratCan Summer School 2014 Vår Gård, Saltsjöbaden.

Promoter and Module Analysis Statistics for Systems Biology.

Combined analysis of ChIP- chip data and sequence data Harbison et al. CS 466 Saurabh Sinha.

Finding regulatory modules from local alignment - Department of Computer Science & Helsinki Institute of Information Technology HIIT University of Helsinki.

Bioinformatics Motif Detection Revised 27/10/06. Overview Introduction Multiple Alignments Multiple alignment based on HMM Motif Finding –Motif representation.

March 03 Identification of Transcription Factor Binding Sites Presenting: Mira & Tali.

Regulatory Motifs. Contents Biology of regulatory motifs Experimental discovery Computational discovery PSSM MEME.

Part II.2 Control of Gene Expression.

Bioinformatics Dr. Aladdin HamwiehKhalid Al-shamaa Abdulqader Jighly Lecture 3 Finding Motifs Aleppo University Faculty of technical engineering.

Next lectures: Differential Gene expression Chapter 5 and websites on syllabus Epigenetic control mechanisms –Histone modification –DNA methylation –Nucleosome.

Identification of a Novel cis-Regulatory Element Involved in the Heat Shock Response in Caenorhabditis elegans Using Microarray Gene Expression and Computational.

Comparative Motif Finding

Transcription factor binding motifs (part I) 10/17/07.

TRANSFAC Project Roadmap Discussion.  Structure DNA-binding domain (DBD)  The portion (domain) of the transcription factor that binds DNA Trans-activating.

Microarrays and Cancer Segal et al. CS 466 Saurabh Sinha.

The Model To model the complex distribution of the data we used the Gaussian Mixture Model (GMM) with a countable infinite number of Gaussian components.

An analysis of “Alignments anchored on genomic landmarks can aid in the identification of regulatory elements” by Kannan Tharakaraman et al. Sarah Aerni.

Introduction to Bioinformatics - Tutorial no. 5 MEME – Discovering motifs in sequences MAST – Searching for motifs in databanks TRANSFAC – The Transcription.

CisGreedy Motif Finder for Cistematic Sarah Aerni Mentors: Ali Mortazavi Barbara Wold.

Biological Sequence Pattern Analysis Liangjiang (LJ) Wang March 8, 2005 PLPTH 890 Introduction to Genomic Bioinformatics Lecture 16.

Promoter Analysis using Bioinformatics, Putting the Predictions to the Test Amy Creekmore Ansci 490M November 19, 2002.

Regulatory Motif Finding

CisGreedy Motif Finder for Cistematic Sarah Aerni Mentors: Ali Mortazavi Barbara Wold.

1 and 3 November, 2006 Chapter 17 Regulation in Eukaryotes.

MCB 317 Genetics and Genomics MCB 317 Topic 10, part 3 A Story of Transcription.

Sigma-aldrich.com/cellsignaling Modular Structure of Transcription Factors.

REGULATORY GENOMICS Saurabh Sinha, Dept. of Computer Science & Institute of Genomic Biology, University of Illinois.

Identifying conserved promoter motifs and transcription factor binding sites in plant promoters Endre Sebestyén, ARI-HAS, Martonvásár, Hungary 26th, November,

Computational Molecular Biology Biochem 218 – BioMedical Informatics Gene Regulatory.

Searching for TFBSs with TRANSFAC - Hot topics in Bioinformatics.

CSCE555 Bioinformatics Lecture 11 Promoter Predication

10/19/05 D Dobbs ISU - BCB 444/544X: Gene Regulation1 10/19/05 Gene Regulation (formerly Gene Prediction - 2)

Transcription factor binding sites and gene regulatory network Victor Jin Department of Biomedical Informatics The Ohio State University.

* only 17% of SNPs implicated in freshwater adaptation map to coding sequences Many, many mapping studies find prevalent noncoding QTLs.

ChIP-on-Chip and Differential Location Analysis Junguk Hur School of Informatics October 4, 2005.

Using Mixed Length Training Sequences in Transcription Factor Binding Site Detection Tools Nathan Snyder Carnegie Mellon University BioGrid REU 2009 University.

Inferring transcriptional and microRNA-mediated regulatory programs in glioblastma Setty, M., et al.

Computational Genomics and Proteomics Lecture 8 Motif Discovery C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E.

Chapters 26 Lehninger 5th Edition

Localising regulatory elements using statistical analysis and shortest unique substrings of DNA Nora Pierstorff 1, Rodrigo Nunes de Fonseca 2, Thomas Wiehe.

MEME homework: probability of finding GAGTCA at a given position in the yeast genome, based on a background model of A = 0.3, T = 0.3, G = 0.2, C = 0.2.

Tools for Comparative Sequence Analysis Ivan Ovcharenko Lawrence Livermore National Laboratory.

How do we represent the position specific preference ? BID_MOUSE I A R H L A Q I G D E M BAD_MOUSE Y G R E L R R M S D E F BAK_MOUSE V G R Q L A L I G.

Recombination breakpoints Family Inheritance Me vs. my brother My dad (my Y)Mom’s dad (uncle’s Y) Human ancestry Disease risk Genomics: Regions  mechanisms.

Pattern Discovery and Recognition for Genetic Regulation Tim Bailey UQ Maths and IMB.

Alternative Splicing (a review by Liliana Florea, 2005) CS 498 SS Saurabh Sinha 11/30/06.

Local Multiple Sequence Alignment Sequence Motifs

Molecular Basis for Relationship between Genotype and Phenotype DNA RNA protein genotype function organism phenotype DNA sequence amino acid sequence transcription.

Last Class 1. Transcription 2. RNA Modification and Splicing

Gene Structure and Identification III BIO520 BioinformaticsJim Lund Previous reading: 1.3, , 10.4,

©2001 Timothy G. Standish James 4:7 7Submit yourselves therefore to God. Resist the devil, and he will flee from you.

Special Topics in Genomics Motif Analysis. Sequence motif – a pattern of nucleotide or amino acid sequences GTATGTACTTACTATGGGTGGTCAACAAATCTATGTATGA TAACATGTGACTCCTATAACCTCTTTGGGTGGTACATGAA.

Introduction to Bioinformatics - Tutorial no. 5 MEME – Discovering motifs in sequences MAST – Searching for motifs in databanks TRANSFAC – the Transcription.

Pattern Discovery and Recognition for Understanding Genetic Regulation Timothy L. Bailey Institute for Molecular Bioscience University of Queensland.

Transcription factor binding motifs (part II) 10/22/07.

Regulation of transcription in eukaryotes

Regulation of Gene Expression

Detection of genome regulation sequences

Transcription Factors

Relationship between Genotype and Phenotype

Relationship between Genotype and Phenotype

Relationship between Genotype and Phenotype

Relationship between Genotype and Phenotype

James 4:7 7 Submit yourselves therefore to God. Resist the devil, and he will flee from you.

Relationship between Genotype and Phenotype

Relationship between Genotype and Phenotype

Presentation transcript:

Sequence Analysis

Programme 1.A Motif-based Framework for Recognizing Sequence Families Sharan, Myers 9:45-10:10am 10:10-10:40am Coffee Break 2.An HMM Posterior Decoder for Sequence Feature Prediction that Includes Homology Information Käll, Krogh, Sonnhammer 10:40-11:05am 3.Self-Organized Clustering Methods for Familial Binding Profiles Mahony, Golden, Smith, Benos 11:05-11:30am 12:15-1:30pm ISCB Open Business Meeting 4.Statistics of Local Multiple Alignments Prakash, Tompa 1:45-2:10pm 5.Computing the P-value of the Information Content from an Alignment of Multiple Sequences Nagarajan, Jones, Keich2:10-2:35pm

What Controls Gene Expression? Transcription factors Regulatory RNAs –miRNA –smRNA –siRNA Methylation Chromatin

Wasserman and Sandelin, (2004) Applied Bioinformatics for the identification of regulatory elements Nature Reviews Genetics (5):

Transcription Factors Proteins which bind DNA Enhance or repress gene expression Families e.g.: –Homeodomain (Hox) –POU domain (Oct-1) –Helix-loop-Helix (c-Myc) –Zinc Fingers (TFIIIA) –Leucine Zipper (c/EBP) –Winged Helix (Fox family) Approx 10% of genes in Human genome are TF’s

TF Noise 577 TFBS

TF Problems TFBS are small and degenerate TGTGGTAML-1a NNNWAAAYAAAYANNNNN FOXJ2_1 AYMAYAATATTTKN FOXJ2_2 TYAAGTG NKX2-5 Upstream sequences (even conserved) are large

Wasserman and Sandelin, (2004)

Conserved Sites 577 TFBS 101 TFBS

Motifs Collections? Databases/experimental data –Transfac –Jaspar De novo searches/motif finding –Xiaohui Xie, Jun Lu, EJ. Kulbokas, Todd Golub, Vamsi Mootha, Kerstin Lindblad-Toh, Eric Lander, Manolis Kellis (2005) Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals Nature, 2005 Feb 27, doi: /nature03441

Motif Finding From unaligned DNA? –Pattern finding –local multiple alignment Benchmark test sets –M. Tompa, N. Li, T. L. Bailey, G. M. Church, B. De Moor, E. Eskin, A. V. Favorov, M. C. Frith, Y. Fu, W. J. Kent, V. J. Makeev, A. A. Mironov, W. S. Noble, G. Pavesi, G. Pesole, M. Regnier, N. Simonis, S. Sinha, G. Thijs, J. van Helden, M. Vandenbogaert, Z. Weng, C. Workman, C. Ye, and Z. Zhu (2005) Assessing Computational Tools for the Discovery of Transcription Factor Binding Sites. Nature Biotechnology, vol. 23, no. 1, –Compared 13 motif finders: AlignACE, ANN-Spec, Consensus, GLAM, Improbizer, MEME, MEME3, MITRA, MotifSampler, oligo/dyad- analysis, QuickScore, SeSiMCMC, Weeder, YMF

Cre-bp1_c_Jun 7.7 HSF213.0 Cart ER22.1 : HSF80.4 SP186.7 …so how do we determine significance? TFBS frequency?