The problem How to integrate the massive amounts of data on Drosophila neurobiology to explore anatomy, formulate hypotheses and find reagents?

Slides:



Advertisements
Similar presentations
More than one way to dissect an animal Melissa Haendel ZFIN Scientific Curator.
Advertisements

Sensory neural systems: What does that mean? What does its study entail? The study of sensory system from the perspective of functional acuity and neural.
Confessions/Disclaimers Ontologies and REDfly CARO SO OBO Foundry.
Copyright © 2004 Pearson Education, Inc., publishing as Benjamin Cummings Fundamentals of Anatomy & Physiology SIXTH EDITION Chapter 13, part 2 The Spinal.
On the Future of the NeuroBehavior Ontology and Its Relation to the Mental Functioning Ontology Barry Smith
+ From OBO to OWL and back again – a tutorial David Osumi-Sutherland, Virtual Fly Brain/FlyBase Chris Mungall – GO/LBL.
Linking Animal Models to Human Diseases Supported by NIH P41 HG and U54 HG the University of Oregon, Eugene, OR
Gene function analysis Stem Cell Network Microarray Course, Unit 5 May 2007.
Genetic dissection of nociception in Drosophila melanogaster Madison L. Shoaf, Wayne L. Silver, Erik C. Johnson Department of Biology, Wake Forest University,
Multiscale Information Modelling for Heart Morphogenesis Tariq Abdulla 13 th IMEKO TC1-TC7 Joint Symposium 02/09/2010.
Flies are quick!. The fly body plan: each segment has a unique identity and produces distinctive structures 3 head 3 thorax 8 abdomen.
Competition degeneracy modularity feedback Elements of robustness:
COG and GO tutorial.
Today’s menu: -UniProt - SwissProt/TrEMBL -PROSITE -Pfam -Gene Onltology Protein and Function Databases Tutorial 7.
Mind, Brain & Behavior Wednesday February 5, 2003.
Protein and Function Databases
BTN323: INTRODUCTION TO BIOLOGICAL DATABASES Day2: Specialized Databases Lecturer: Junaid Gamieldien, PhD
Part 1 Biology 12.  An integral part of your body’s communication system.  It plays an important role in the smooth functioning of the body.  The nervous.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Gain modulation as a mechanism for the selection of functional circuits Emilio Salinas Melanie Wyder Nick Bentley Dept. of Neurobiology and Anatomy Wake.
Integrating digital atlases of the brain: atlas services with WPS Ilya Zaslavsky San Diego Supercomputer Center, UCSD Lead of the INCF Digital Atlasing.
Computational Biology and Informatics Laboratory Development of an Application Ontology for Beta Cell Genomics Based On the Ontology for Biomedical Investigations.
GO and OBO: an introduction. Jane Lomax EMBL-EBI What is the Gene Ontology? What is OBO? OBO-Edit demo & practical What is the Gene Ontology? What is.
Outline Quick review of GS Current problems with GS Our solutions Future work Discussion …
Open Biomedical Ontologies. Open Biomedical Ontologies (OBO) An umbrella project for grouping different ontologies in biological/medical field –a repository.
March 24, Integrating genomic knowledge sources through an anatomy ontology Gennari JH, Silberfein A, and Wiley JC Pac Symp Biocomputing 2005:
Copyright © 2004 Pearson Education, Inc., publishing as Benjamin Cummings Fundamentals of Anatomy & Physiology SIXTH EDITION Frederic H. Martini PowerPoint.
Figure 30.1 Sexually dimorphic anatomy in the hawk moth, Manduca sexta
Atlas Interoperablity I & II: progress to date, requirements gathering Session I: 8:30 – 10am Session II: 10:15 – 12pm.
Alan Ruttenberg PONS R&D Task force Alan Ruttenberg Science Commons.
Sunday, July 22, 2012 Plan Areas of coverage: high-level neurological system process, inc. sensory perception, sensory processing, cognition transmission.
1 Machine Learning 1.Where does machine learning fit in computer science? 2.What is machine learning? 3.Where can machine learning be applied? 4.Should.
University of Illinois at Urbana-Champaign BeeSpace Navigator v4.0 and Gene Summarizer beespace.uiuc.edu `
Alastair Kerr, Ph.D. WTCCB Bioinformatics Core An introduction to DNA and Protein Sequence Databases.
Visually guided attention during flying OR Pilots “do not like” fovea because they cannot pay attention to more than 1% of space at any one time.
Building WormBase database(s). SAB 2008 Wellcome Trust Sanger Insitute Cold Spring Harbor Laboratory California Institute of Technology ● RNAi ● Microarray.
Networks of Neuronal Genes Affected by Common and Rare Variants in Autism Spectrum Disorders.
Cell Ontology Meeting, Jackson Labs May 2010 David Osumi-Sutherland.
F learning & memory in flies F environmental sources of plasticity F genetic dissection of learning & memory F anatomical mutants F biochemical mutants.
Master headline RDFizing the EBI Gene Expression Atlas James Malone, Electra Tapanari
18 April 2007 IB 429: Animal Behavior Physiology of Behavior Prof. Fred Delcomyn Office:422A Morrill Hall Phone:
NEUROSCIENCE AS AN INTEGRATED DISCIPLINE
Chapter 2. From Complex Networks to Intelligent Systems in Creating Brain-like Systems, Sendhoff et al. Course: Robots Learning from Humans Baek, Da Som.
Phenotype And Trait Ontology (PATO) and plant phenotypes
Genetic Analysis of Ephrin-A2 and Ephrin-A5 Show Their Requirement in Multiple Aspects of Retinocollicular Mapping Interdisciplinary Program in Brain Science.
Copyright OpenHelix. No use or reproduction without express written consent1.
Atlas Interoperablity I & II: progress to date, requirements gathering Session I: 8:30 – 10am Session II: 10:15 – 12pm.
Anatomy Ontologies & Potential Users: Bridging the Gap Ravensara Travillian European Bioinformatics Institute
The Cardiovascular Disease Ontology (CVDO) Mercedes Arguello Casteleiro 1, Julie Klein 2 and Robert Stevens 1 1 School of Computer Science, University.
Mapping the Circuitry for Drosophila Male MT 2 Middlebury College, Mapping the Circuitry for Drosophila Male Aggression Walker, AM 12*, Bailey, SJ 3 1.
       January 3 rd, 2005 The signaling properties of the individual neuron. How we move from understanding individual nerve cells.
transformer and Sex determination in Drosophila
Behavior and Phenotype in GMOD Natural Diversity in GMOD
Conceptual approach for incorporating “omics” technologies and resulting large databases into toxicological evaluation. Data from experiments that evaluate.
Mental Functioning and the Gene Ontology
Michael Meredith Biological Science
Social Interactions in “Simple” Model Systems
Metabolic Pathways and Additional Levels of Regulation: Attenuation
Eliza Congdon, Russell A. Poldrack, Nelson B. Freimer  Neuron 
Sexual Dimorphism in the Fly Brain
Approaches in psychology: Posters
Genetic Identification and Separation of Innate and Experience-Dependent Courtship Behaviors in Drosophila  Yufeng Pan, Bruce S. Baker  Cell  Volume 156,
Circadian Pacemaker Neurons Transmit and Modulate Visual Information to Control a Rapid Behavioral Response  Esteban O. Mazzoni, Claude Desplan, Justin.
Volume 25, Issue 10, Pages (May 2015)
Volume 23, Issue 2, Pages (April 2018)
Neuroscience Review.
Invertebrate Neuroethology: Food Play and Sex
BTB/POZ-Zinc Finger Protein Abrupt Suppresses Dendritic Branching in a Neuronal Subtype-Specific and Dosage-Dependent Manner  Wenjun Li, Fay Wang, Laurent.
How Does the Brain Smell?
Sex and the Single Splice
Presentation transcript:

The problem How to integrate the massive amounts of data on Drosophila neurobiology to explore anatomy, formulate hypotheses and find reagents?

Behavior/neural process ontology on FlyBase Gene ontology annotations of genes – neurological system process 7,904 annotations coverring 3,099 proteins and 121 terms – behavior 1,964 annotations coverring 932 proteins and 89 terms Phenotypes – Number of annotations: 4961 – Number of terms used in annotation: 24 – all defined using GO. Gene ontology annotations of anatomical structures – neurological system process: 1479 detection of stimulus involved in sensory perception: 1467 – GO behavior: 17

Genetic dissection of neural circuit function transgenic driver(s) target expression to specific neuron classes repress neural activity activate modulate behavior direct assays of neural activity UAS - < some activity modulator > Mutant

Expresses Fru Scer\GAL4[fru-NP0021] Expresses DA1 vPN GO: response to pheromone GO: sensory perception of smell GO: male courtship behavior Function Phenotype Anatomical phenotypes

registration (warping) e.g.- neurons with some part in AMMC QUERIES computation of overlap 3D co-ordinates for neuron Neuron based bioinformatics: tracking 3D data 3D co-ordinates for Brain regions segmentation Standard brain => standard 3D coordinate space

Analysis of cross-registered 3 D image data Predicted innervation patterns NeuronBlast => predictions of neuron classes Predicted connectivity from Arbor proximity

300 µm / 40,000 neurons 3D overlap defines potential connectivity Output

300 µm / 40,000 neurons 3D overlap defines potential connectivity

Queries Neurons by function (inferred from phenotype or electrophysiology) Phenotypes due to modulation of neurons in expression domain of driver X Potential circuit partners – direct or indirect, with X function

Functional annotation using GO

What we need Clear definitions and safe inference – infer classification Avoid vertebrate specificity – references to anatomical structures – references to species specific movement types – Bundling together of functions in species specific ways (vestibulo-auditory) Cross ontology integration – GO; Uberon; CHEBI, PATO