Fusarium strain identification in different grain and feed samples collected from last year's harvest Oana-Maria Ioja-Boldura

The Fusarium genus has a global distribution and many species in the genus are phytopathogenic fungi infecting a wide range of crop plants including cereals such as maize, wheat, oat and barley. Fusarium contamination is a major agricultural problem as quality and yield can be reduced, but more importantly many species in the genus produce mycotoxins responsible for serious diseases in humans and farm animals.

Fusarium head blight (FHB) in small-grain cereals and maize ear and stem rot are caused by several Fusarium species. The Fusarium species that are predominantly found in association with FHB in small-grain cereals all over Europe are F. graminearum (Gibberella zeae), F. avenaceum and F. culmorum (Bottalico and Perrone, 2002), However, F. poae, F. tricinctum, F. sporotrichioides, F. equiseti and F. langsethiae are also very commonly found (Kosiak et al., 2003; Bottalico and Perrone, 2002). F. graminearum was previously thought to be one single specie but recently it has been shown that several species exist within this complex (O'Donnell et al., 2004).

In maize the most frequently isolated species include: F. graminearum, F. avenaceum, F. cerealis, F. culmorum (maize red ear rot), F.verticillioides (G. moniliforme), F. proliferatum and F. subglutinans (maize pink rot), but also F. equiseti, F. poae, F. sporotrichioides, F. acumitatum, F. solani, F. semitectum and F. oxysporum are occasionally found (Logrieco et al., 2002).

The trichothecenes constitute the largest group of mycotoxins produced by Fusarium. The most common trichothecene in cereals is deoxynivalenol (DON) produced by certain isolates of F. graminearum, F. pseudograminearum and F. culmorum. Another closely related trichothecene, nivalenol (NIV) is also produced by isolates of these species, and by F. equiseti and F. poae. T-2 toxin (T2) and HT-2 toxin (HT2) are produced by F. sporotrichioides, F. langsethiae and few isolates of F. poae whereas many isolates of F. poae and F. equiseti produce diacetoxyscirpenol (DAS), F. avenaceum and F. tricinctum produce other mycotoxins such as enniatins and moniliformin. The main mycotoxins are zearalenone (ZEA) deoxynivalenol (DON) and fumonisins (FUM). F. proliferatum and F. verticillioides are producers of fumonisins (FUM) which are carcinogenic to animals and possibly also to humans.

Preliminary studies were focused in optimizing the DNA extraction method and adapting the PCR program, in order to obtain optimal and accurate results. Biological material : DNA extracted from: 8 samples of commercial feeds (labeled A, B, C, D, E, F, G, H) and 4 maize samples ( with determined GMO content, labeled a, b, c, d.) For this samples the mycotoxins content was previously determined.

PCR analyzes SpeciePrimers sequenceAmplicon size (bp) Fusarium spp. 5 ’ ATGGGTAAGGAGGACAAGAC 3 ’ 3 ’ GGAAGTACCAGTGATCATGTT 5 ’ 750 F. graminearum 5 ’ GTTGATGGGTAAAAGTGTG 3 ’ 3 ’ CTCTCATATACCCTCCG 5 ’ 500 F. proliferatum 5 ’ CGGCCACCAGAGGATGTG 3 ’ 3 ’ CAACACGAATCGCTTCCTGAC 5 ’ 230 F.verticillioides 5 ’ CGCACGTATAGATGGACAAG 3 ’ 3 ’ CACCCGCAGAATCCATCCATCAG 5 ’ 700 Tri 7 DON biosynthetic gene 5 ’ TGCGTGGCAATATCTTCTTCCTA 3 ’ 3 ’ GTGCTAATATTGTGCTAATATTGTGC 5 ’ Tri 13 DON biosynthetic gene 5 ’ CATCATGAGACTTGTGTCAGAGTTTGGG 3 ’ 3 ’ GCTAGATCGATTGTTGCATTGAG 5 ’ 282

DNA extraction and purification method - CTAB method Quantification of the extracted DNA by spectophotometric method BioMate Spectrophotometer- ThermoScientific 100 mg ground material was mixed with 300 μl water and then 700 μl CTAB buffer was added together with 20 μl RNase solution (10 mg/ml) before incubation at 65 °C for 30 min. And then 10 μl proteinase K solution (20 mg/ml) was added before an incubation at 65 °C for 30 min. samples were centrifuged at 12,000 ×g for 10 min and the supernatant was transferred to a tube with 500 μl chloroform, vortexed and centrifuged at 12,000 ×g for 15 min. the upper layer was transferred to a new tube and 2 volumes of CTAB precipitation solution were added and the samples were incubated at RT for 60 min before centrifugation at 12,000 ×g for 5 min. the pellet was dissolved in 350 μl 1.2 M NaCl and 350 μl chloroform was added before vortexing and centrifugation at 12,000 ×g for 10 min. the upper layer was precipitated with 0.6 volumes of isopropanol and incubated at RT for 20 min and centrifuged at 12,000 ×g for 10 min. the pellet was washed in 70% ethanol, vacuum dried and resuspended in 100 μl MQ water.

Amplification was performed in a Corbett RESEARCH Thermal Cycler, folowing the indications from literature. Amplicons were analyzed by electrophoresis on 2% agarose gel (Promega, USA) and visualized in Ethidium Bromide (0.4 ng/ml) presence. PCR reagents: Go Taq Green Master Mix PCR kit from Promega 2X. 20 pmol of each primer. different concentrations of DNA template. in a final volume – 25 µl.

Feed samples lane 1, feed sample A lane 2, feed sample B ; lane 3, feed sample C ; lane 4, feed sample D ; lane 5, feed sample E ; lane 6, feed sample F ; lane 7, feed sample G ; lane 8, feed sample H ; lane 9, negative DNA template; lane 10, control reagent; lane 11, molecular weight marker: PCR marker,Promega lane 1, feed sample A lane 2, feed sample B ; lane 3, feed sample C ; lane 4, feed sample D ; lane 5, feed sample E ; lane 6, feed sample F ; lane 7, feed sample G ;lane 8, feed sample H ;lane 9, negative DNA template; lane 10, control reagent; lane 11, molecular weight marker: PCR marker,Promega Fusarium spp. Fusarium verticillioides

lane 1, molecular weight marker: PCR marker,Promega; lane 2, feed sample A lane 3, feed sample B ; lane 4, feed sample C ; lane 5, feed sample D ; lane 6, feed sample E ; lane 7, feed sample F ; lane 8, feed sample G ;lane 9, feed sample H ; lane 10, control reagent; lane 1, feed sample A lane 2, feed sample B ; lane 3, feed sample C ; lane 4, feed sample D ; lane 5, feed sample E ; lane 6, feed sample F ; lane 7, feed sample G ; lane 8, feed sample H ; lane 9, negative DNA template; lane 10, control reagent; lane 11, molecular weight marker: PCR marker,Promega Fusarium proliferatum Fusarium graminearum

lane 1, feed sample A lane 2, feed sample B ; lane 3, feed sample C ; lane 4, feed sample D ; lane 5, feed sample E ; lane 6, feed sample F ; lane 7, feed sample G ; lane 8, feed sample H ; lane 9, negative DNA template; lane 10, control reagent; lane 11, molecular weight marker: PCR marker,Promega lane 1, feed sample A lane 2, feed sample B ; lane 3, feed sample C ; lane 4, feed sample D ; lane 5, feed sample E ; lane 6, feed sample F ; lane 7, feed sample G ; lane 8, feed sample H ; lane 9, negative DNA template; lane 10, control reagent; lane 11, molecular weight marker: PCR marker,Promega Tri 7 DON biosynthetic gene Tri 13 DON biosynthetic gene

Maize samples lane 1, maize sample a; lane 2, maize sample b; lane 3, maize sample c; lane 4, maize sample d; lane 5, negative DNA template; lane 6, control reagent; lane 7, molecular weight marker: PCR marker,Promega lane 1, molecular weight marker: PCR marker,Promega, lane 2, maize sample a;lane 3, maize sample b; lane 4, maize sample c; lane 5, maize sample d; lane 6, negative DNA template; lane 7, control reagent. lane 1, maize sample a; lane 2, maize sample b; lane 3, maize sample c; lane 4, maize sample d; lane 5, negative DNA template; lane 6, control reagent; lane 7, molecular weight marker: PCR marker,Promega. Fusarium graminearum Fusarium proliferatum Fusarium verticillioides

Discussions : The CTAB method was successfully used for extracting fungal DNA from vegetal matrices as it was proved by PCR results. Fusarium spp. and their toxin biosynthetic genes can be precisely detected, identified and differentiated by qualitative PCR methods. Further experiments will be focused in finding and applying the best extraction method for other vegetal matrices (i.e. wheat) and also for fungal cells. Increasing the range of fungal species detection by PCR methods.

Thank you for your attention!