By: Brett Kratchman. Colorblindness is a defect of vision affecting the ability to distinguish colors, occurring mostly in males. Color blindness is caused.

Slides:



Advertisements
Similar presentations
Colorblindness is a defect of vision affecting the ability to distinguish colors, occurring mostly in males. Color blindness is caused by a defect in the.
Advertisements

Chapter 9: Color Vision. Overview of Questions How do we perceive 200 different colors with only three cones? What does someone who is “color-blind” see?
How can we use lenses to correct vision?. If the image is turned upside down too soon, what lens would we use? What if the image was turned upside down.
Two equally true statements: The only thing we can hear is sound. The only thing we can see is light.
Color Vision Our visual system interprets differences in the wavelength of light as color Rods are color blind, but with the cones we can see different.
Wavelength and Color Recall that light is electromagnetic radiation.
ARAVIND EYE CARE SYSTEM A R A V I N D E Y E H O S P I T A L & Postgraduate Institute of Ophthalmology Madurai, India ARAVIND EYE CARE SYSTEM A R A V I.
Night and Color Blindness
Color blindness B y : M a r e i M ü n s t e r, M o l l y S u l l i v a n, a n d A l e x a n d r a O l i v a n.
By: Caleb Earley.  The cone cells are located in the human eye  More specifically found in the retina of the human eye.
THE HUMAN EYE Lights and Lenses. Explore: How does the eye focus an image? Procedure: -Position yourself so you can clearly see an object across the room.
VISION DEFECTS.
By Akash Velu Velu, Akash 12/10/11 P2B Abrams  Color Blindness  Color Deficiency  These are the only two names for color blindness. However, there.
Hayley Dardick and Taylor Kiyota. How is it inherited?  Color blindness is usually inherited and is due to mutations on the X chromosome.  Mutations.
[ White Light Red Light Green Light Blue Light.
Color Blindness By Russell Luther. The Basics Color blindness is a very common disorder, and is also known as Color vision Deficiency. Every different.
1 Testing sensory visual function. 2 types: 1) psychophysical tests 2) electrophysical tests.
The Visual System: The Structure of the Visual System Module 9: Sensation.
1. Provide an example of sensory adaptation. No longer hearing the buzzing of the projector.
Human Vision. The pupil is the dark transparent region in the centre of the eye where light enters. The iris is the coloured circle of muscle surrounding.
(c) McGraw Hill Ryerson Human Vision The pupil is the dark transparent region in the centre of the eye where light enters. The iris is the coloured.
 Condition in which certain colors can not be distinguished  Red-Green most common (99%)  Blue-Yellow; Rare no test available.
Color blindness By Robert, Will, John and Enri 7-4.
Visuals: Anastasia Veloudos Facts: Dahlia Glanton Speaker: Madison Williams NIGHT AND COLOR BLINDNESS.
© 2011 The McGraw-Hill Companies, Inc. Instructor name Class Title, Term/Semester, Year Institution Introductory Psychology Concepts Vision.
12.2 Essential Questions How do you see color? What is the difference between light color and pigment color? What happens when different colors are mixed?
The Visual System. The Nature of Light Electromagnetic Spectrum – An energy spectrum that includes X-rays, radar, and radio waves – A small portion of.
VISION From Light to Sight. Objective To describe how the receptor cells for vision respond to the physical energy of light waves and are located in the.
Color Blindness Brian Go H2E-10 Jeremiah Pua H2E-27.
***see notes for page 11 Margot Sweeney Kelly Brustman.
Color Blindness “Color blindness is the inability to see certain colors in the usual way.” By: Alex Murfree.
Colours of light can be added together to form a variety of colours.
Human Vision. Correcting Focus Problems Near-sighted vision  Can not clearly focus on distant objects.  Occurs because the lens converges the light.
(c) McGraw Hill Ryerson Human Vision The pupil is the dark transparent region in the centre of the eye where light enters. The iris is the coloured.
HOW THE EYE WORKS. A cross section of the human eye The image cast on the retina is upside down, then turned right side up by the brain.
BIOLOGY 12 Sex-Linked Traits. in humans, sex is determined by the 23rd pair of chromosomes known as “sex chromosomes” XX = female XY = male X: ~ 1400.
The Visual System: The Structure of the Visual System Module 9: Sensation.
9 TH GRADE SCIENCE CHAPTER 14 B Light and Color. Color Color:  Due to reflected light  Reflect all light  White  Reflect no light  Black Filters:
Optical Illusions & Color Blindness Tests The human eye has cone cells for detecting red, blue, and green light. These cells are used for daylight vision.
The EYE.
Color Blindness “Color Vision Deficiency”. What is it? Our eyes determine Color the wavelength of a light seen Photoreceptors send Chemical messages to.
The Visual System: The Structure of the Visual System.
Unit 3 Light and Optical Systems Topic 6 The Source of Colors Remember to name and date your notes!
The Structure & Function of the Eye. How you Detect Light Visible light is the part of the electromagnetic spectrum that can be detected by your eyes.
COLOR BLINDNESS By: Haley Stroud, Conor Presto, Ethan Davis, Kayla Hall, , and Dante McGuire.
By Maddy Jones, Coby Austin, Ellie Stiller, and Deon Robinson.
Perception of stimuli Option A.3. Receptors detect changes in the environment. List and describe the types of specialized receptors in humans. a. Mechanoreceptors-
How many colors do our eyes really detect?. ANSWER: 3.
Visual acuity and color vision. Aims and Objectives Understand the principles behind vision testing Perform an accurate visual acuity To differentiate.
Colour blindness.
Psychological dimensions:
Unit 4: Sensation & Perception
The Visual System: The Structure of the Visual System Module 9: Sensation.
Sensation. The process by which our sensory systems (eyes, ears, and other sensory organs) and nervous system receive stimuli from the environment A person’s.
Vision. The Eye and Vision It’s the most complex and most important sense for humans. The vision “system” transfers light waves into neural messages that.
The Visual System: The Structure of the Visual System
Visual Perception Human Body Systems © 2014 Project Lead The Way, Inc.
Additive Colour Theory
“Don’t make me read, make me understand “
Visual Perception Human Body Systems © 2014 Project Lead The Way, Inc.
Zach Van Sickle Alyssa Kaeser
Colour Vision Section 12.4.
Color blindness A world of gray?
VISION Module 18.
Two equally true statements:
Visual Perception Human Body Systems © 2014 Project Lead The Way, Inc.
Visual Perception Human Body Systems © 2014 Project Lead The Way, Inc.
Colours of light can be added together to form a variety of colours
Chapter 6.1 Human Vision.
Vision.
Presentation transcript:

By: Brett Kratchman

Colorblindness is a defect of vision affecting the ability to distinguish colors, occurring mostly in males. Color blindness is caused by a defect in the retina or in other nerve portions of the eye. Also known as dichromatism, this disease consists of the inability to differentiate between reds and greens.

The signs and symptoms of colorblindness depend on certain factors: Is the problem congenital, acquired, partial, or complete? Does the patient have trouble distinguishing reds and greens? Is the patient experiencing reduced vision?

Color vision deficiency is usually detected using colored charts called the Ishihara Test Plates. The plates consist of gray and colored dots. The patient is asked to identify the number in the middle of the circle. After the patient has identified what they see, more testing may commence. Vision test examples. Normal people should see 74. Color deficient people may see D=21.

A random pattern of gray level dots is first put together. A digit pattern is then added which is defined by yellow/blue variation only. Since most people with red/green colorblindness can see yellow/blue they will be able to see the digit 5 in this test pattern. Another digit pattern which is defined by red/green variation is added. Here is the pattern composed of the random brightness pattern and the red/green pattern. Finally all three are added: People with red/green deficiency will not be able to see the red/green pattern and will see the 5. People with normal vision will see both the patterns, but since the red/green is stronger than the yellow/blue, the normal person will see the digit 6.

Most color-blind people see normally in all other aspects other than the color of their weakened cone. Color-blind people can usually learn by experience to associate certain colors with different sensations of brightness. Many victims of the defect are unaware that they are color-blind. Weak green cone Weak red cone

Gene OPN1MW GC0XP (and information) Start: 148,439,714 bp from pter End: 148,453,078 bp from pter Size:13,364 bases Orientation: plus strand

Gene OPN1LW GC0XP (and information) Start: 147,547,307 bp from pter End: 147,561,950 bp from pter Size: 14,643 bases Orientation: plus strand

>ENST ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGC AGGACAGCTATGAGGACAGCACCCAGTCCAGCATCTTCACCTACACC AACAGCAACTCCACCAGAGGCCCCTTCGAAGGCCCGAATTACCACA TCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATGATCTTT GTGGTCATTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCAC CATGAAGTTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTG AACCTGGCGGTCGCTGACCTGGCAGAGACCGTCATCGCCAGCACTA TCAGCGTTGTGAACCAGGTCTATGGCTACTTCGTGCTGGGCCACCCT ATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGG TCTCTGGTCTCTGGCCATCATTTCCTGGGAGAGATGGATGGTGGTCT GCAAGCCCTTTGGCAATGTGAGATTTGATGCCAAGCTGGCCATCGTG GGCATTGCCTTCTCCTGGATCTGGGCTGCTGTGTGGACAGCCCCGCC CATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAGACTTCAT GCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTC TTACATGATTGTCCTCATGGTCACCTGCTGCATCACCCCACTCAGCAT CATCGTGCTCTGCTACCTCCAAGTGTGGCTGGCCATCCGAGCGGTGG CAAAGCAGCAGAAAGAGTCTGAATCCACCCAGAAGGCAGAGAAGG AAGTGACGCGCATGGTGGTGGTGATGGTCCTGGCATTCTGCTTCTGC TGGGGACCATACGCCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGG CTACCCCTTCCACCCTTTGATGGCTGCCCTGCCGGCCTTCTTTGCCAA AAGTGCCACTATCTACAACCCCGTTATCTATGTCTTTATGAACCGGCA GTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAGGTTGACGATG GCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGTCC TCGGTATCGCCTGCATGA

>ENST ATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGC AGGACAGCTATGAGGACAGCACCCAGTCCAGCATCTTCACCTACACC AACAGCAACTCCACCAGAGGCCCCTTCGAAGGCCCGAATTACCACA TCGCTCCCAGATGGGTGTACCACCTCACCAGTGTCTGGATGATCTTT GTGGTCACTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCAC CATGAAGTTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTG AACCTGGCGGTCGCTGACCTAGCAGAGACCGTCATCGCCAGCACTAT CAGCATTGTGAACCAGGTCTCTGGCTACTTCGTGCTGGGCCACCCTA TGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATCACAGGT CTCTGGTCTCTGGCCATCATTTCCTGGGAGAGGTGGCTGGTGGTGTG CAAGCCCTTTGGCAATGTGAGATTTGATGCCAAGCTGGCCATCGTGG GCATTGCCTTCTCCTGGATCTGGTCTGCTGTGTGGACAGCCCCGCCC ATCTTTGGTTGGAGCAGGTACTGGCCCCACGGCCTGAAGACTTCATG CGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCA GTCTTACATGATTGTCCTCATGGTCACCTGCTGCATCATCCCACTCGC TATCATCATGCTCTGCTACCTCCAAGTGTGGCTGGCCATCCGAGCGGT GGCAAAGCAGCAGAAAGAGTCTGAATCCACCCAGAAGGCAGAGAA GGAAGTGACGCGCATGGTGGTGGTGATGATCTTTGCGTACTGCGTCT GCTGGGGACCCTACACCTTCTTCGCATGCTTTGCTGCTGCCAACCCT GGTTACGCCTTCCACCCTTTGATGGCTGCCCTGCCGGCCTACTTTGCC AAAAGTGCCACTATCTACAACCCCGTTATCTATGTCTTTATGAACCGG CAGTTTCGAAACTGCATCTTGCAGCTTTTCGGGAAGAAGGTTGACGA TGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTGT CCTCGGTATCGCCTGCATGA

Accession Number CodonNucleotideAmino acidPhenotype CM aTGC-CGCCys-ArgTrichromacy, deutan Nucleotide substitutions (missense / nonsense)

Accession Number CodonNucleotideAmino acidPhenotype CM aTGC-CGCCys-Arg Blue cone monochromatism Nucleotide substitutions (missense / nonsense)

ColorMax has recently introduced a tinted lens for glasses. ColorMax lenses are designed to improve the vision of specific colors that look the same to people with red green color deficiencies. However, the vision of other colors has actually been impaired. Other than these lenses, there isn’t much that can be done to cure color blindness, thus making research obsolete.

Rhodospin, the receptor protein in rod cells, crosses the disc membrane seven times. Its odd shape is shared by three receptor proteins in cone cells. Retinal (which absobs light) is shown in purple. The other balls (yellow) represent amino acids which make up the rhodospin structure.

Unfortunately, there is nothing that can be done once diagnosed with color blindness. Color blindness is a life long condition that can exclude people from certain jobs such as a pilot or a job that would include electronics. If you suspect colorblindness, you can visit an ophthalmologist or your health care provider. Being aware of the disease is the best way to help someone overcome this disease.