TELOMERES Dr. José María Romero Romero

TELOMERES are specialized structures at the end of all eukaryotic chromosomes. contain longthy streches of non-coding tandemly repeated sequence, (TTAGGG)n, and specific proteins. ensure chromosome stability and protect the ends from degradation and from fusing with other chromosomes. TELOMERES:

TELOMERES Normal somatic cells lose telomeric repeats with ongoing cell division. Telomere length is quite important for cells because they work as a buffer avoiding the loss of coding DNA.

TELOMERES The loss of telomeric repeats triggers replicative senescense in cells. Telomeres sequences are extraordinary highly conserved in evolution: all vertebrates have the same simple sequence repeat.

TELOMERES There is an important enzyme: TELOMERASE, active only in embryonic, proliferatice cells of renewal tissues, adult male germline and cancer cells, that is the main regulator of telomere´s length. TELOMERASE is a reverse transcriptase ( a RNA- dependent polymerase) that contains an RNA with the sequence complementary to the telomere repeat TTAGGG. RNA´s polymerase is used as the template.

TELOMERES The model for telomeres is that they are the physical ends of linear eukaryotic chromosomes that contain up to 15 Kb of non-coding tandemly repeated sequence: (TTAGGG)n, and specific proteins, and an overhang of nucleotides in the chromosome terminus.

TELOMERES DNA Chromosome 5-15kb nt (3´overhang) DNA tandem repeat - (TTAGGG) n Old model of a human telomere 5’ 3’

3´overhang, 200 nt T- LOOP D-LOOP AATCCCAATCCCAA TCCCAAT TTAGGGTTAGGGTTAGGGTTA 5´ 3´ TELOMERES 5´ New model of a human telomere

3´overhang, 100 nt D-LOOP AATCCCAATCCCAA TCCCAAT TTAGGGTT 5´ 3´ TELOMERES 5´ During senescense most overhang drop below 100 nt, potencially disrupting the T-loop or another telomeric structure. This telomere structure hasn´t stability

TELOMERES 5´ 3´ 3´overhang erosion seems to be a direct result of continued cellular division and not of the senescense program itself, so when there are about 100 nt... Chromosomal destabilization is linked to malignancies Damaged chromosomes are degraded by nucleases and participate in end joining reactions that fuse two free ends.