Supplementary Figure 1A

Slides:

Advertisements

Similar presentations

Proteins: Structure reflects function….. Fig. 5-UN1 Amino group Carboxyl group carbon.

Advertisements

Oxalate (µmol/gFW) Itaconate (µmol/gFW) r=-0.702** Citrate (µmol/gFW) r=0.389 Isocitrate (µmol/gFW) Ascorbate (µmol/gFW) r=0.052 r=0.195 New Leaves 10.

The Chemical Nature of Enzyme Catalysis

By: Tiffany J. Simmons Pd. 6. GGTCCAATGCCCGCCAGCCTAGCTCCAGTGCTTCTAGTAGGAGGGCTGAAAGGGA GCAACTTTTCCTCCAATCCTGGAAATTCGACACAATTAGATTTG AACTC GCTGGAAATACAACACATGTTAAATCTTAAGTACAAGGGGGAAAAAATAAATCAGTTA.

A Ala Alanine Alanine is a small, hydrophobic

Superposition of 3hvp and 2hvp Helix present in 3hvp but missing from 2hvp N-terminal residues 1-5 ordered in 3hvp Loop is different in the 2 structures.

BY: SHERENE MINHAS. Agr Glu Thr Ile Glu Ser Leu Ser Ser Ser Glu Glu Ser Ile Pro Glu Tyr Lys Gln Lys Val Glu Lys Val Lys His Glu Asp Gln Gln Gln Gly Thr.

Aminoácidos Unidad de las proteínas. Isómeros Clasificación Esenciales Valina (Val) Leucina (Leu) Isoleucina (Ile) Fenilalanina (Phe) Metionina (Met)

Chapter 26 Amino Acids Metabolism.

5’ C 3’ OH (free) 1’ C 5’ PO4 (free) DNA is a linear polymer of nucleotide subunits joined together by phosphodiester bonds - covalent bonds between.

Environmental Biology for Engineers and Scientists D.A. Vaccari, P.F. Strom, and J.E. Alleman © John Wiley & Sons, 2005 Chapter 3 – The Substances of Life.

Protein-a chemical view A chain of amino acids folded in 3D Picture from on-line biology bookon-line biology book Peptide Protein backbone N / C terminal.

Amino Acids and Proteins 1.What is an amino acid / protein 2.Where are they found 3.Properties of the amino acids 4.How are proteins synthesized 1.Transcription.

Lectures on Computational Biology HC Lee Computational Biology Lab Center for Complex Systems & Biophysics National Central University EFSS II National.

Amino Acids, Peptides, Protein Primary Structure

Ensemble Results of PIM1 PIM PIM Ensemble Results of GSK3 GSK GSK GSK

©CMBI 2008 Aligning Sequences The most powerful weapon in the bioinformaticist’s armory is sequence alignment. Why? Lets’ think about an alignment. It.

It og Sundhed Thomas Nordahl Petersen, Associate Professor Center for Biological Sequence Analysis, DTU

Lipids A. Classified based on solubility (like dissolves like) 1. insoluble in polar solvents 2. soluble in nonpolar solvents 3. lipids are hydrophobic.

©CMBI 2005 Why align sequences? Lots of sequences with unknown structure and function. A few sequences with known structure and function If they align,

Beta Sheet Alignment with Cyclic Coordinate Descent David Arndt - May 18, 2007.

Other structure programs Insight II Swiss PDB-Viewer QUANTA/CHARMm and Quanta 2005 for proteins SYBYL with FUGUE and FlexX for drugs O or FRODO for x-ray.

The relative orientation observed for  helices packed on ß sheets.

Protein Structure FDSC400. Protein Functions Biological?Food?

Amino Acids, Peptides, and Proteins.. Classification of Amino Acids.

Proteins. The central role of proteins in the chemistry of life Proteins have a variety of functions. Structural proteins make up the physical structure.

Marlou Snelleman 2012 Proteins and amino acids. Overview Proteins Primary structure Secondary structure Tertiary structure Quaternary structure Amino.

Chapter 27 Amino Acids, Peptides, and Proteins. Nucleic Acids.

1.What makes an enzyme specific to one type of reaction (in other words, what determines the function of a protein)? –SHAPE determines the function of.

Protein Synthesis. DNA RNA Proteins (Transcription) (Translation) DNA (genetic information stored in genes) RNA (working copies of genes) Proteins (functional.

On the nature of cavities on protein surfaces: Application to the Identification of drug-binding sites Murad Nayal, Barry Honig Columbia University, NY.

BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 4 Protein Sequence.

Digestion and Absorption Johnson Chap Jack L. Leonard 2004.

Mount Mary College Students: Jessica Benson, Amy Ramirez, Nerissa Seward Faculty Advisor: Dr. Colleen Conway Medical College of Wisconsin Research Mentor:

PM3&ZnB/SCRF optimized aqueous structure with 1 explicit water Zinc ASP7–HIS13–HIS14–HIS6 PM3&ZnB/SCRF optimized aqueous structure 7) 7) A.

Classification of Proteases

LESSON 4: Using Bioinformatics to Analyze Protein Sequences PowerPoint slides to accompany Using Bioinformatics : Genetic Research.

Today Building a genome –Nucleotides, GC content and isochores –Gene structure and expression; introns –Evolution of noncoding RNAs Evolution of transcription.

Secondary structure prediction

Learning Targets “I Can...” -State how many nucleotides make up a codon. -Use a codon chart to find the corresponding amino acid.

Welcome Back! February 27, 2012 Sit in any seat for today. You will have assigned seats tomorrow Were you absent before the break? Plan on coming to tutorial.

Amino acids Met dank aan Dr. Detke.

intro-VIRUSES Virus NamePDB ID HUMAN PAPILLOMAVIRUS 161DZL BACTERIOPHAGE GA1GAV L-A virus1M1C SATELLITE PANICUM MOSAIC VIRUS1STM SATELLITE TOBACCO NECROSIS2BUK.

A program of ITEST (Information Technology Experiences for Students and Teachers) funded by the National Science Foundation Background Session #3 DNA &

1 Protein synthesis How a nucleotide sequence is translated into amino acids.

Amino Acids ©CMBI 2001 “ When you understand the amino acids, you understand everything ”

Marlou Snelleman 2011 Proteins and amino acids. Overview Proteins Primary structure Secondary structure Tertiary structure Quaternary structure Amino.

Proteins Structure of proteins Proteins are made of C, H, O and nitrogen and may have sulfur. The monomers of proteins are amino acids An amino acid.

©2001 Timothy G. Standish Hebrews 12:28 28Wherefore we receiving a kingdom which cannot be moved, let us have grace, whereby we may serve God acceptably.

Biphasic insulin aspart 30 + metformin vs once-daily insulin glargine + glimepiride Kann P, Regulski M, Medding J, Ligthelm R A study in people with type.

X-ray detection xray/facilities.html.

Kami, et al. Supplementary Fig. S2A. Kami, et al. Supplementary Fig. S2B.

Supplementary Fig. S2 Elution profiles of amino acid derivatives in a UPLC system. The enzyme (1 μg) was incubated with 10 mM D -amino acid (2.5 mM D -Tyr)

Supplementary Fig. 1 Relative concentrations of amino acids after transamination reaction catalyzed by PpACL1, α- ketoglutarate as the amino acceptor.

Chapter 17 How to read a table of codons. These are two forms in which you might see a table of codons.

Stephen Taylor i-Biology.net Photo credit: Firefly with glow, by Terry Priest on Flickr (Creative Commons)

Amino Acids and Proteins Amino Acids. L-isoleucine.

Amino acids Common structure of 19 AAs H3N+H3N+ COO - R H C Proline.

COO - R group Amino group Carboxylic group L -Form Amino Acid Structure  H = Glycine CH 3 = Alanine H N 3 + H Juang RH (2004) BCbasics.

Arginine, who are you? Why so important?. Release 2015_01 of 07-Jan-15 of UniProtKB/Swiss-Prot contains sequence entries, comprising

Table 2. the contents of free amino acids

Cathode (attracts (+) amino acids)

מרכיבי הדם.

Figure 3.14A–D Protein structure (layer 1)

Amino Acids Amine group -NH2 Carboxylic group -COOH

Tay Sachs vs Sickle cell

How to Test an Assertion

B*35:01 B*35:05 Supplementary Figure 2. Flexibility difference at residue 97 between HLA-B*35:01 and HLA-B*35:05. Residue 97 in HLA-B*35:01 (Arg (R)) and.

Presentation transcript:

Supplementary Figure 1A Residue 22 D (Asp) E (Glu) Residue 81 I (Ile) V (Val) Residue 132 H (His) Y (Try) Residue 154 Residue 160 A (Ala)

Residue 270N Residue 270I Residue 301S Residue 301T T (Thr) N (Asp) I (Ile) Residue 270I Residue 301T L (Leu) Residue 301S S (Ser) Residue 302 G(Gly) Residue 380,383,386 K (Lys) R(Arg)

Supplementary Figure 1B Residue 68 I (Ile) V (Val) Residue 169 A (Ala) R (Arg) K (Lys) Residue 231 Residue 303 T (Thr) Residue 391 Supplementary Figure 1B

Supplementary Figure 1C Residue 140 I (Ile) T (Thr) Supplementary Figure 1C