Sickle Cell Disease normal red blood cells sickled red blood cells Lesson 6 normal red blood cells sickled red blood cells Slide 4.1 -Make sure the students understand the following points. Red blood cells become banana shaped when oxygen is low in the blood. The oddly shaped cells cause blockages. The blockages cause pain, damage to tissue and organs, even death. Interview with sickle cell patient: pain

Hemoglobin Hemoglobin subunit Red Blood Cell Oxygen molecule Lesson 6 Slide 4.2 - Revisit the function of hemoglobin from students exercise at the end of Lesson 2. . Tell students hemoglobin is a protein in red blood cells. Ask students if they remember what its function isﾑmay have to provide hints. Show cartoon image of the protein in a cell (from lesson 2 ﾑ see below) and ask students to describe what is going on in this image and what hemoglobin does. Point out hemoglobin is made of four subunits. Each subunit is a single chain of amino acids. But, unlike the other proteins they’ve studied, in order for hemoglobin to function it needs three partner proteins. Carrying oxygen is a four protein job. Each individual protein chain is called a subunit. Oxygen molecule

Chromosomal location of Hemoglobin Lesson 6 Chromosomal location of Hemoglobin Chromosome 11 Hemoglobin gene Slide 4.3 - Point out to students that if we are going to examine the hemoglobin gene, we need to know where it is. Point out the location of one of the hemoglobin genes on chromosome 11.

Mutation found in Hemoglobin Lesson 6 Mutation found in Hemoglobin Sequence of normal hemoglobin DNA: CTGACTCCTGAGGAGAAGTCT GACTGAGGACTCCTCTTCAGA Amino acids: Sequence found in sickling hemoglobin DNA: CTGACTCCTGTGGAGAAGTCT GACTGAGGACACCTCTTCAGA

Mutation found in Hemoglobin Lesson 6 Mutation found in Hemoglobin Sequence of normal hemoglobin DNA: CTGACTCCTGAGGAGAAGTCT GACTGAGGACTCCTCTTCAGA Amino acids: L T P E E K S Sequence found in sickling hemoglobin DNA: CTGACTCCTGTGGAGAAGTCT GACTGAGGACACCTCTTCAGA Amino acids: L T P V E K S Slide 4.5 and 4.6 - Explain that scientists have explored this mutation and its affect on hemoglobin and have determined there is a problem. Hemoglobin forms long chains inside red blood cells. Then show cartoon images showing this. Explain to students that the hydrophobic parts of proteins like to clump together (like hydrophobic amino acids). In this case the abnormal hydrophobic patch on the outside of the protein, can interact with other nearby sickle cell hemoglobins when no oxygen is present forming long crystals of hemoglobin inside of the red blood cells. In contrast normal hemoglobin proteins stay separated when no oxygen is present. The long chains in of sickle cell hemoglobin stretch the red blood cell so that it looks banana shaped.

Sickle Cell Hemoglobins Stick Together Lesson 6 Normal hemoglobin Sickle Cell hemoglobin No Oxygen No oxygen Slide 4.5 and 4.6 - Explain that scientists have explored this mutation and its affect on hemoglobin and have determined there is a problem. Hemoglobin forms long chains inside red blood cells. Then show cartoon images showing this. Explain to students that the hydrophobic parts of proteins like to clump together (like hydrophobic amino acids). In this case the abnormal hydrophobic patch on the outside of the protein, can interact with other nearby sickle cell hemoglobins when no oxygen is present forming long crystals of hemoglobin inside of the red blood cells. In contrast normal hemoglobin proteins stay separated when no oxygen is present. The long chains in of sickle cell hemoglobin stretch the red blood cell so that it looks banana shaped. No Oxygen: Separate No Oxygen: stuck together

Effects of Sickle Cell Mutation Lesson 6 Effects of Sickle Cell Mutation CTGACTCCTGAGGAGAAGTCT GACTGAGGACTCCTCTTCAGA CTGACTCCTGTGGAGAAGTCT GACTGAGGACACCTCTTCAGA DNA order of amino acids L T P E E K S L T P V E K S protein shape Slide 4.7 - Students struggle to make connections from genes to traits so use this slide to walk through the steps from gene to protein to trait. cell function

Lesson 6 Frequency of Sickle Cell Causing Mutation vs. Frequency of Malaria Causing Microbe % of population that has HbS (Sickle Cell mutation) Africa Africa High frequency of Malaria causing microbe Slide 4.8 - Present maps of malaria and sickle cell to introduce an interesting finding. Present the interesting finding that malaria frequency and the frequency of the sickle cell mutation are correlated in geographic areas of the world. Have students identify overlap in areas. Ask question such as do you see an overlap, what do you think this means, do you think there could be some benefit to having sickle cell in these areas or perhaps one is causing the other. Explain that scientist have looked into this case and have found surprising results.