Blackett Family DNA Paternity Study ACGCACTTCAGAACGCGTACTGACTGAA TGCGTGAAGTCTTGCGCATGACTGACTT 2 3 4 Blackett Family DNA Paternity Study

Use of Short Tandem Repeats Non-coding sections (do not code from proteins) Inherited from parents Individuals have 2 copies (alleles)

13 CODIS Core STR Loci with Chromosomal Positions TPOX D3S1358 TH01 D8S1179 D5S818 VWA FGA D7S820 CSF1PO AMEL D13S317 AMEL D16S539 D18S51 D21S11

Short Tandem Repeats Short repeats of bases in non-coding DNA STRs are short sequences of DNA, normally of length 2-5 base pairs, that are repeated numerous times Example: the 16 bp sequence of "gatagatagatagata" would represent 4 copies of the tetramer "gata". Number of STR repeats vary with individuals The polymorphisms (variations in DNA sequence between individuals) in STRs are due to the different number of copies of the repeat element that can occur in a population of individuals.

STR genotyping is performed by comparison of sample data to allelic ladders Microvariant allele

Short Tandem Repeats (STRs) AATG 7 repeats 8 repeats A person inherits a copy (allele) of the STR from each parent. Homozygote = both alleles are the same length Heterozygote = alleles differ and can be resolved from one another

STR-D7S280 1 aatttttgta ttttttttag agacggggtt tcaccatgtt ggtcaggctg actatggagt 61 tattttaagg ttaatatata taaagggtat gatagaacac ttgtcatagt ttagaacgaa 121 ctaacgatag atagatagat agatagatag atagatagat agatagatag atagacagat 181 tgatagtttt tttttatctc actaaatagt ctatagtaaa catttaatta ccaatatttg 241 gtgcaattct gtcaatgagg ataaatgtgg aatcgttata attcttaaga atatatattc 301 cctctgagtt tttgatacct cagattttaa ggcc D7S280 is one of the 13 core CODIS STR genetic loci. This DNA is found on human chromosome 7.The tetrameric repeat sequence of D7S280 is "gata". Different alleles of this locus have from 6 to 15 tandem repeats of the "gata" sequence. How many tetrameric repeats are present in the DNA sequence shown above? Notice that one of the tetrameric sequences is "gaca", rather than "gata".

Blackett Family DNA Study In this activity, you will learn the concepts and techniques behind DNA profiling of the 13 core CODIS "Short Tandem Repeat" loci used for the national DNA databank. You will then have the opportunity to collect and interpret actual STR data, and to answer one or more of the following questions: 1. How is STR data used in a DNA Paternity Test? 2. How can STR data from close relatives be used to create a genetic profile of a missing person? 3. How much genetic diversity exists among siblings? 4. How does one calculate the probability for a specific DNA profile?

Blackett Family Step 1: Build a family tree Person Family Relationship Bob Husband – Starting of genealogical chart Anne Wife David Son Katie Daughter Fred Father Norma Mother Karen Sister Steve Husband of Karen Tiffany Daughter of Karen and Steve Melissa Amanda Louise Sister of Fred; Bob's Aunt Bud Husband of Louise Buddy Son of Bud and Louise Dick Marilyn Daughter of Bud and Louise Janet Step 1: Build a family tree

Key Terms Allele. The different forms of a gene. Different STR repeat lengths represent different alleles at a genetic locus, i.e. 8 and 9 are different alleles of the THO1 locus. Locus. The position on a specific chromosome where the different alleles of a genetic marker are located. The plural is loci. Genotype. The genetic composition of the alleles at a locus. Since we are diploid, we each have two alleles at each locus.

Key Terms Homozygous. Both alleles at a locus are the same, i.e. Fred has a genotype of 29, 29 at the D21S11 locus. Heterozygous. Alleles at a locus are not the same, i.e. Normal has a genotype of 29, 31 at the D21S11 locus. Multiple Allelic Series. Many different alleles at a locus, i.e. the known alleles at the vWA locus are 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21. Punnett Square. A diagram used to determine all possible genotypes that can occur in a genetic cross.

Punnett Square If the genotypes of both parents are known, we use a Punnett Square to predict the possible phenotypes of their offspring. Each child inherits one allele of a given locus from each parent. Panel (a) - At the D21S11 locus, the children of Bob Blackett and wife Anne can have four different genotypes. Son David is 28, 31. Daughter Katie is 29, 30. Panel (b) - Bob Blackett inherited the 31 allele from his mother, Norma. Therefore the 29 allele is paternal. If Bob's paternal was not 29, what would be your conclusion?

Step 2: Analysis of STR data for the Blackett family Examine the chart and table provided to you. How are the alleles represented? How are the alleles reported?

How are alleles reported? Buddy Dick Marilyn Janet D3S1358 18, 18 15, 16 vWA 16, 18 16, 17 FGA 19, 19 19, 21 AMEL X Y X X D8S1179 13, 15 12, 13 D21S11 29, 30 28, 29 D18S51 12, 18 17, 18 D5S818 11, 13 10, 12 10, 13 D13S317 11, 12 D7S820 10, 10 7, 11 D16S539 9, 11 THO1 9.3, 10 6, 9.3 TPOX 10, 11 CSF1PO 12, 12 How are alleles reported? STR Data for Buddy, Dick, Marilyn and Janet Suggestion: Compare the chart and the table.

Step 2 - STR Data for the Blackett Family These data are from the actual DNA analysis of the Blackett family members by Bob Blackett. The tracings show the genotypes for three of the 13 CODIS STR loci. In this activity, you will record the data for use in the ensuing genetic analysis of the Blackett family. 1. Collect the data for Bob, Anne, David, Katie, Fred and Norma for the "Paternity Testing with STR" Activity. 2. Collect the data for Karen, Tiffany, Melissa, and Amanda for the "DNA Profile of a Missing Person" Activity.

Here is Bob's DNA Profile for the 13 core Genetic Loci of the A DNA Profile: The 13 CODIS STR loci As part of his training and proficiency testing for DNA Profile analysis of STR Polymorphisms, Forensic Scientist and DNA Analyst Bob Blackett created a DNA Profile on his own DNA. Here is Bob's DNA Profile for the 13 core Genetic Loci of the United States national database, CODIS (Combined DNA Index System): Locus D3S1358 vWA FGA D8S1179 D21S11 D18S51 D5S818 Genotype 15, 18 16, 16 19, 24 12, 13 29, 31 11, 13 Frequency 8.2% 4.4% 1.7% 9.9% 2.3% 4.3% 13% Locus D13S317 D7S820 D16S539 THO1 TPOX CSF1PO AMEL Genotype 11, 11 10, 10 9, 9.3 8, 8 X Y Frequency 1.2% 6.3% 9.5% 9.6% 3.52% 7.2% (Male)

Step 3: Paternity Testing with STR Data 1. Who are the biological parents of David and Katie? Do all of the data you have collected on the genotypes of Bob, Anne, Katie, and David support the conclusion that Bob and Anne are the biological parents of David and Katie? You should justify your answer by reference to the specific genotypes for the STR loci.

Step 3: Paternity Testing with STR Data 2. What is the genetic legacy of Fred and Norma? The alleles that Bob passes on to his children have in turn been inherited from Bob's parents, Fred and Norma. Identify the alleles among the 13 CODIS STR loci in the genotypes of Katie and David that have been un-ambigously inherited from each of their paternal grandparents. Now identify any additional alleles that might have been inherited from their paternal grandparents.