Lichens and Ascomycota broadly Alternative markers to COI ITS.

Slides:

Advertisements

Similar presentations

A Separate Analysis Approach to the Reconstruction of Phylogenetic Networks Luay Nakhleh Department of Computer Sciences UT Austin.

Advertisements

Phylogenetically Mapping Liverwort-Fungal Associations Jessica Nelson Duke University Jessica Nelson Duke University.

DNA barcoding and evolutionary relationships in Accipiter Brisson,1760 (Aves, Falconiformes: Accipitridae) with a focus on African and Eurasian representatives.

 Aim in building a phylogenetic tree is to use a knowledge of the characters of organisms to build a tree that reflects the relationships between them.

Developing phyloinformatic tools for an evolutionary understanding of molecular biodiversity Fran ç ois Lutzoni Duke University Department of Biology Durham,

Phylogeny Systematics Cladistics

THE EVOLUTIONARY HISTORY OF BIODIVERSITY

1 General Phylogenetics Points that will be covered in this presentation Tree TerminologyTree Terminology General Points About Phylogenetic TreesGeneral.

Plant Molecular Systematics (Phylogenetics). Systematics classifies species based on similarity of traits and possible mechanisms of evolution, a change.

Molecular Evolution Revised 29/12/06

How missing data and taxon sampling play the role in Phylogeny reconstruction? A case study on a five-gene dataset of Eurotiomycetous endophytic fungi.

CHAPTER 25 TRACING PHYLOGENY. I. PHYLOGENY AND SYSTEMATICS A.TAXONOMY EMPLOYS A HIERARCHICAL SYSTEM OF CLASSIFICATION  SYSTEMATICS, THE STUDY OF BIOLOGICAL.

Chapter 2 Opener How do we classify organisms?. Figure 2.1 Tracing the path of evolution to Homo sapiens from the universal ancestor of all life.

Classification and Phylogenies Taxonomic categories and taxa Inferring phylogenies –The similarity vs. shared derived character states –Homoplasy –Maximum.

CIS786, Lecture 8 Usman Roshan Some of the slides are based upon material by Dennis Livesay and David.

“Species Trees”. What is the “species tree?” The true tree (when there is one) The population tree The dominant history ????

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Analysis of Microbial Community Structure

Molecular Microbial Ecology

Molecular phylogenetics

What’s it all about?. Taxonomy Classification Creating groups Use characters Systematics Phylogenetic reconstruction.

Prokaryote Taxonomy & Diversity

* only 17% of SNPs implicated in freshwater adaptation map to coding sequences Many, many mapping studies find prevalent noncoding QTLs.

Bioinformatics 2011 Molecular Evolution Revised 29/12/06.

Patterns of divergent selection from combined DNA barcode and phenotypic data Tim Barraclough, Imperial College London.

Christian Arnold Bioinformatics Group, University of Leipzig Bioinformatics Herbstseminar October 23th, 2009 Three Weeks of Experience at the formatics.

Gene Prediction: Similarity-Based Methods (Lecture for CS498-CXZ Algorithms in Bioinformatics) Sept. 15, 2005 ChengXiang Zhai Department of Computer Science.

CHARACTERS USED IN RECONSTRUCTING PHYLOGENETIC TREES 1. Morphological “ Tiktaalik is the sister group of Acanthostega + Ichthyostega in one of the two.

Chapter 10 Phylogenetic Basics. Similarities and divergence between biological sequences are often represented by phylogenetic trees Phylogenetics is.

Introduction to Phylogenetic trees Colin Dewey BMI/CS 576 Fall 2015.

Phylogeny & the Tree of Life

DNA barcoding and evolutionary relationships in Accipiter Brisson,1760 (Aves, Falconiformes: Accipitridae) with a focus on African and Eurasian representatives.

Algorithmic research in phylogeny reconstruction Tandy Warnow The University of Texas at Austin.

Phylogeny & Systematics

All life is interconnected by descent

Ayesha M.Khan Spring Phylogenetic Basics 2 One central field in biology is to infer the relation between species. Do they possess a common ancestor?

The Big Issues in Phylogenetic Reconstruction Randy Linder Integrative Biology, University of Texas

CS 395T: Computational phylogenetics January 18, 2006 Tandy Warnow.

Systematics of Clavicipitaceous Fungi Associated with Morning Glories Based on rpb1 Sequence Data Saroj Simkhada, Alyssa M. Brown, and Richard E. Miller.

Darwin’s Tree of Life, July million species Phylogenetic inference from genomic.

Metagenomic Species Diversity.

Introduction to Bioinformatics Resources for DNA Barcoding

Phylogenetic basis of systematics

Phylogeny & the Tree of Life

DNA Marker Lecture 10 BY Ms. Shumaila Azam

Genome Projects Maps Human Genome Mapping Human Genome Sequencing

Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.

Systematics: Tree of Life

Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.

Genome Evolution: Horizontal Movements in the Fungi

BNFO 602 Phylogenetics Usman Roshan.

BNFO 602 Phylogenetics – maximum parsimony

Taxonomical classification is recognizing and registering the worlds organism diversity – continual changing knowledge about evolutionary and ecological.

Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.

Genome Evolution: Horizontal Movements in the Fungi

Systematics: Tree of Life

Chapter 19 Molecular Phylogenetics

Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.

Phylogeny and Systematics (Part 6)

Taxonomic identification and phylogenetic profiling

Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.

Molecular data assisted morphological analyses

Warm-Up Contrast adaptive radiation vs. convergent evolution? Give an example of each. What is the correct sequence from the most comprehensive to least.

For Grouping and Naming Organisms

Unit Genomic sequencing

Study phylogeny in the context of species evolution

Phylogenetic tree based on predominant 16S rRNA gene sequences obtained by C4–V8 Sutterella PCR from AUT-GI patients, Sutterella species isolates, and.

Tree depicting the phylogenetic relationships of all strains included in this study. Tree depicting the phylogenetic relationships of all strains included.

Presentation transcript:

Lichens and Ascomycota broadly Alternative markers to COI ITS

Why? Easy to amplify and sequence Mixture of highly conserved (5.8S) and variable sites (ITS 1 and 2) Most broadly used marker for systematic and ecological studies of fungi at the species level Highest overlap with other genes (AFToL) Alignment issues across a broad phylogenetic spectrum can be dealt with

Most broadly used marker for taxonomic and ecological studies of fungi at the species level Highest number of reference sequences = highest identification accuracy Detection of fungal contaminants in DNA isolates (endolichenic fungi closely related to lichen mycobionts) Essential to detect and characterize the hyperdiverse unknown Ascomycota species (70, m)

> 95%

Most broadly used marker for taxonomic and ecological studies of fungi at the species level Highest number of reference sequences = highest identification accuracy Detection of fungal contaminants in DNA isolates (endolichenic fungi closely related to lichen mycobionts) Essential to detect and characterize the hyperdiverse unknown Ascomycota species (70, m)

Highest overlap with other genes (AFToL) What are the putative ecological/physiological roles? What are the most closely related taxa? = phylogenies ≠ similarity Reconstruction of trait evolution on comprehensive phylogenies Branch lengths are important and trees not significantly worse than the optimal tree are needed = Bayesian MCMC searches More genes needed (nucSSU, nucLSU, RPB1, RPB2)

Most endophytes & endolichenic fungi are Ascomycota. Beyond this level, specificity is an open question. Parasitism vs. mutualism? Horizontal vs. vertical transmission?

Alignment issues across a broad phylogenetic spectrum can be dealt with Decouple tree searches from phylogenetic placement of unknowns Phylogenies need to be based on multigene datasets Use ITS only to search phylogenetic placement of unknown on a backbone constraint tree 5.8S can be aligned across the fungi (life), and ITS 1 and 2 can be coded to provide new sets of characters (arc)

ARC Miadlikowska et al., Mycologia, 2003