What is the most important function of assessment?

Assessment: More Than Just Grades Michelle Withers West Virginia University

Assessment Learning Goals Participants will be able to: Explain how formative assessment enhances student learning Distinguish between formative and summative assessments Explain how summative assessment drives learning. Align learning goals with summative and formative assessments

So, how do we know what we know?

“… because as we know, there are known knowns; things we know we know. We also know there are known unknowns; that is to say we know there are some things we do not know. But there are also unknown unknowns – the ones we don’t know we don’t know.” Donald Rumsfeld Huh?

Think-Pair-Share How do you know when you know something? How do you know when your students know something? How do your students know when they know something?

“Ongoing assessment plays a key role – possibly the most important role – in shaping classroom standards and increasing learning gains.” Black and Wiliam, 1998

How people learn PRIOR KNOWLEDGE DISSONANCE CONSTRUCTION OF NEW KNOWLEDGE Everyone has an understanding of how the world works: some ideas are correct, some incomplete, some wrong. New information challenges these views. If consistent with the view, the info validates that view. If inconsistent, the difference must be reconciled and explained. In reconciling how the new information contradicts a view, new neural networks form.

Assessments help confront misconceptions

As the acorn grows into the tree, from where does the of the majority of the biomass come? 1.Air 2.Soil 3.Water 4.Sun

Assessments help students distinguish between what they know and what they don’t know.

Genetic diseases, like PKU, confirm that there is a link between an individual’s DNA and that individual’s proteins. Below is a DNA molecule and the amino acid sequence that would result from translating the DNA sequence. Which nucleotides are responsible for this particular sequence of amino acids? What do you know? What do you need to know? 3’CGTTTTACCAAACCGAGTACTGAG 5’GCAAAATGGTTTGGCTCATGACTC TRP-PHE-GLY-SER

Assessments can aid construction of new knowledge

(AAAS 1999) These represent the average for an entire population Based on your understanding of natural selection and traits that vary along a continuum, explain the changes that occurred in the tree and dinosaur populations over time?

Assessments allow students and instructors to gauge students’ progress during learning.

Darwin at the Olympics Work with your group to modify the 100- meter dash such that it would become an example of natural selection.

Representative answers “Add hurdles” “Make the runners run over rocky, uneven ground to select for the ones with best balance and speed” “Release a tiger behind the runners” “Kill the losers” “Only the first two runners across the finish line can reproduce”

Three identical plates of radish seeds are incubated under three conditions, with results as shown. Their DRY weights in increasing order will be: 1.1, 2, 3 2.1, 3, 2 3.3, 2, 1 4.3, 1, 2 5.All the same

Reflection What did you learn or experience in the role of student? What feedback did the assessments offer the students? How do you think this feedback compares with a traditional lecture classroom?

EnGaugements When you ask a student to do something, they are simultaneously engaged in learning and can gauge their progress by whether or how well they can perform. –Handelsman et al., 2006 Scientific Teaching.

Edu-Speak Demystified: Formative assessments –Classroom assessments, homework, online assignments –Occur during the teaching event –Provide regular feedback to both the instructor and the students during the learning process Summative assessments –Exams, papers, presentations –Typically occur at the end of teaching –Usually major part of grade for the class

THE MONTILLATION AND USES OF TRAXOLINE It is very important to learn about traxoline. Traxoline is a new form of zionter. It is montilled in Ceristanna. The Ceristannians found that they could gristerlate large amounts of fervon and then bracter it to quasel traxoline. This new, more efficient bracterillation process has the potential to make traxoline one of the most useful products within the molecular family of lukizes snezlaus. QUIZ: 1. What is traxoline? 2. Where is it montilled? 3. How is traxoline quaseled? 4. Why is traxoline important?

Bloom’s Taxonomy can be used to align of outcomes and assessments Benjamin S. Bloom Taxonomy of educational objectives. Published by Allyn and Bacon, Boston, MA. Copyright (c) 1984 by Pearson Education. Higher cognitive orders (HOCS) Lower cognitive orders (LOCS)

What % of higher order Bloom’s level questions would you expect to find on an typical intro bio exam? A.0-20 B C D E

Application of Bloom’s Taxonomy Debunks the “MCAT Myth” Alex Y. Zheng, Janessa K. Lawhorn, Thomas Lumley, and Scott Freeman25 JANUARY 2008 VOL 319 SCIENCE

Alignment Learning Goal Outcome (content + behavior) ActivityAssessment (final) What will students learn? If they have learned it, what will students know and be able to do? What will students do to learn it? How will students demonstrate they know it or are able to do it? Students will understand the transfer of information from DNA to proteins during gene expression. Students will be able to determine the effect that a mutation will have on the sequence of a protein. Students will work in groups to identify the template strand and reading frame of a section of a PKU gene using the amino acid sequence of that gene and determine the result of a given mutation. Given a section of a gene and its corresponding amino acid sequence, students will determine the new amino acid sequence that results from a given mutation.

Case of the frustrated student This semester, I enrolled in intro microbiology. I approach this class like most others: I attend lecture, read the textbook and turn in the homework if it’s going to be graded. Prof. Lopez is great; he’s really well organized and follows the book closely. The homework has been helpful for learning the terms and information. The first midterm exam in this course was NOT what I expected. None of the questions were multiple choice. We had to write our short answers and essays. I barely had time to finish the exam. Plus three of the questions tested us on things we never learned and skipped stuff we had covered in class. For example, we learned about the lac operon last week and it wasn’t even on the test. But there was this question asking us to “describe a strategy that bacteria use to regulate gene expression. How am I supposed to know about that? I got a 72% on the test. What a crock. Forget microbiology; it’s not for me. »(Handelsman et al., 2006)

Reflection What is the most important function of assessment? Is your answer the same or different than it was before this workshop? Why or how?

Summary Formative assessment is one of the most important strategies for aiding/improving learning Summative assessment lets students know what we think is important, so it drives learning Alignment between learning goals, summative assessments and formative assessments/active learning is key!

Acknowledgments Clarissa Dirks, Evergreen State College National Academies Summer Institute on Undergraduate Biology Education