Friday 11/14/2014 Take a notes sheet from the front table. Get out your warm-up sheet & answer the following: What is the complementary strand for the below DNA strand? ACTGCACCTGAGCGTATTGAC TGACGTGGACTCGCATAACTG
Blast from the Past… 1. Who makes proteins in the cell? 2. What are proteins made of?
Protein Synthesis
DNA vs.RNA Double-stranded Deoxyribose A,G, C, T Single stranded Ribose A, G, C, U
DNA vs.RNA
Nucleus The office The Boss never leaves
DNA – The Boss
mRNA – Ms. Rene Secretary She’s a foreigner In her language Uhere is no “T”
Protein Synthesis Protein synthesis is the making of proteins, using the information that is found in DNA. Proteins are long chains of small molecules called amino acids. Different proteins are made by using a different sequence of amino acids. Pieces of information in DNA are called genes.
From HHMI’s Biointeractive: DNA Animations/Transcription (basic) NAi_transcription_vo1.html
Transcription: means write across Protein synthesis begins with the DNA molecule. The DNA of this gene will unzip like it does in replication. *The enzyme that separates the DNA strand at a specific gene is helicase. In protein synthesis, only one strand of the DNA will be used.
Transcription A single strand of mRNA forms and transcribes (copies) the genetic information from the DNA. This strand of RNA is called messenger RNA or mRNA. *The enzyme that connects and assembles the ribonucleotides is called RNA polymerase The DNA “zips” closed and remains in the nucleus. The mRNA will leave the nucleus and travel to a ribosome.
RNA which stands for RIBONUCLEIC ACID is single stranded, contains a ribose sugar, and has Uracil instead of Thymine.
Comparing RNA and DNA Image courtesy of Wikimedia Commons
T A G T C A T C A G G 5’ 3’ 5’ 3’ A T C A G T A G T C C 5’ 3’ G T C A U AAAAAA TTTTT C C CCC GG G G GG UUUU 5’ DNA Helicase Touch the helicase!
T A G T C A T C A G G 5’ 3’ 5’ 3’ A T C A G T A G T C C 5’ 3’ G T C A U AAAAA A TTTTT C C CCC GG G G GG UUUU 5’ Assemble your mRNA strand!! Hit Me when done!
T A G T C A T C A G G 5’ 3’ 5’ 3’ A T C A G T A G T C C 5’ 3’ G T C A U AAAAAA TTTTT C C CCC GG G G GG UUUU 5’ RNA polymerase U C C C A A A G G U U
T A G T C A T C A G G 5’ 3’ 5’ 3’ A T C A G T A G T C C 5’ 3’ A A A U U C C G G U C 5’
Quick Review!
Where does TRNASCRIPTION take place?
Nucleus The office The Boss never leaves
Where do we get the information to make different types of proteins?
DNA – The Boss
Who delivers the message to the workers?
mRNA – Ms. Rene Secretary She’s a foreigner In her language Uhere is no “T”
Quick Quiz What is the name of the enzyme that unwinds DNA? What is the process where a secret message goes ACROSS the nuclear membrane? What carries the sequence from the DNA out of the nucleus? How many strands are copied on the original DNA molecule? What happens to the DNA once the messenger detaches?
TCCGCGCAGAGCTAG AGGCGCGUCUCGAUC Transcribe the following DNA strand: