Protein Synthesis $100 $200 $300 $400 $500 $100$100$100 $200 $300 $400 $500 Central Dogma Basics Transcription RNA Mutations FINAL ROUND Translation

Central Dogma Basics : $100 Question This is the place where transcription takes place in eukaryotic cells BACK TO GAME ANSWER

Central Dogma Basics : $100 Answer BACK TO GAME Nucleus

Central Dogma Basics : $200 Question BACK TO GAME ANSWER These are the parts of mRNA that do not code for protein

Central Dogma Basics: $200 Answer BACK TO GAME introns

Central Dogma Basics : $300 Question BACK TO GAME ANSWER This is the site where translation takes place

Central Dogma Basics : $300 Answer BACK TO GAME Ribosomes (in cytoplasm or on Rough ER)

Central Dogma Basics: $400 Question BACK TO GAME ANSWER This is a sequence of DNA that codes for protein(s)

Central Dogma Basics : $400 Answer BACK TO GAME Gene

Central Dogma Basics : $500 Question BACK TO GAME ANSWER This is the central dogma

Central Dogma Basics : $500 Answer BACK TO GAME DNA  RNA  Protein

Transcription: $100 Question BACK TO GAME ANSWER This is the enzyme that synthesizes mRNA

Transcription : $100 Answer BACK TO GAME RNA polymerase

Transcription : $200 Question BACK TO GAME ANSWER This is the region of DNA where RNA polymerase binds

Transcription : $200 Answer BACK TO GAME Promotor

Transcription : $300 Question BACK TO GAME ANSWER This is the portion of DNA that signals transcription to stop

Transcription: $300 Answer BACK TO GAME Terminator

Transcription : $400 Question BACK TO GAME ANSWER This is the process takes place after transcription in which mRNA is edited

Transcription : $400 Answer BACK TO GAME mRNA splicing

Transcription : $500 Question How does mRNA exit the nucleus BACK TO GAME ANSWER

Transcription : $500 Answer BACK TO GAME Through nuclear pores

Translation: $100 Question BACK TO GAME ANSWER This is the start codon

Translation : $100 Answer BACK TO GAME AUG

Translation : $200 Question BACK TO GAME ANSWER This is the site on the ribosomes in which polypeptide chain grows

Translation : $200 Answer BACK TO GAME P site

Translation : $300 Question BACK TO GAME ANSWER These are the type of bonds that exist between amino acids

Translation : $300 Answer BACK TO GAME peptide bonds

Translation : $400 Question BACK TO GAME ANSWER This is the site on the ribosome in which the next tRNA enters the ribosome

Translation : $400 Answer BACK TO GAME A site

Translation: 500 BACK TO GAME ANSWER Describe initiation of translation

Translation : 500 BACK TO GAME mRNA finds a ribosome and binds to it; the start codon (AUG) codes for a tRNA carrying the amino acid methionine; this tRNA enters the ribosome at the P site and translation begins

RNA: $100 Question BACK TO GAME ANSWER This type of RNA contains codons

RNA: $100 Answer BACK TO GAME mRNA

RNA: $200 Question BACK TO GAME ANSWER This type of RNA contains anti-codons

Translation : $200 Answer BACK TO GAME tRNA

RNA : $300 Question BACK TO GAME ANSWER This type of RNA carries amino acids

RNA : $300 Answer BACK TO GAME tRNA

RNA : $400 Question BACK TO GAME ANSWER RNA is different from DNA because…..

RNA : $400 Answer BACK TO GAME Ribose sugar; Uracil instead of Thymine; single stranded

RNA : $500 Question BACK TO GAME ANSWER These are the types of RNA involved in translation

RNA: $500 Answer BACK TO GAME mRNA, tRNA, rRNA

Mutations: $100 Question BACK TO GAME ANSWER This type of mutation codes for the same amino acid therefore there is no effect on the protein

Mutation: $100 Answer BACK TO GAME Silent mutation

Mutation : $200 Question BACK TO GAME ANSWER This type of mutation involves a substitution of a nucleotide that results in a stop codon reached to soon therefore the polypeptide chain is not complete and the protein is nonfunctional

Mutation : $200 Answer BACK TO GAME Nonsense mutation

Mutation : $300 Question BACK TO GAME ANSWER Insertion or deletion of a nucleotide will result in this type of mutation

Mutation : $300 Answer BACK TO GAME Frameshift

Mutation: $400 Question BACK TO GAME ANSWER This type of mutation is a substitution which results in a different amino acid

Mutation : $400 Answer BACK TO GAME Missense mutation

Mutation : $500 Question BACK TO GAME ANSWER Why can one difference in amino acid sequence be harmful?

Mutation : $500 Answer BACK TO GAME The protein shape can be altered by just one change in amino acid; if the shape is incorrect the function of the protein is incorrect

FINAL ROUND Question BACK TO GAME ANSWER Transcribe and Translate the following gene…. 5’ TTTCAGCTACAAAGAGTAGATT 3’

FINAL ROUND Question BACK TO GAME ANSWER DNA= 5’TTTCAGCTACAAAGAGTAGATT 3’ mRNA=3’AAAGUCAUGUUUCUCAUCUAA 5’ Amino acids = (start)met- phe- leu- iso- stop