Big Idea #2 & 3: Structure Meets Function of Nucleic Acids Replication Transcription Translation

Replication What function of DNA does this process accomplish? –Role of DNA polymerase

Diversity Mutation is the ultimate source for diversity. Mutation ONLY occurs during replication!

Transcription and Translation

Transcription Where? Why is DNA read “ backwards? ” Molecules involved: –RNA polymerase: Moves in the 5’ to 3’ direction…so what strand does it READ? –DNA-->mRNA

Translation Where? How does the concept of structure meets function apply? Molecules involved: –mRNA “ codons ” –tRNA “ anticodons ” –rRNA

Function: DNA codes for proteins Actually “ mRNA ” is the “ codon ”

How can changing DNA change a protein? A case study Sickle Cell: –What change in the DNA alters the shape of the hemoglobin protein? –Why does this change occur?

DNA Sequences HBB Sequence in Normal Adult Hemoglobin (Hb A Protein) –3’CAAGTAAACATAGGACTTCTT 5’ HBB Sequence in Mutant Adult Hemoglobin (Hb S Protein) –3’CAAGTAAACATAGGACATCTT 5’

What to do? Determine the mutation that has been passed down (replication). Determine the Amino Acid sequence (using transcription and translation). Using an amino acid chart, determine WHY the shape change might occur. –Suggest what amino acid subsitutions may not have had such a drastic effect. –Suggest which amino acid subsitutions would have a similar effect.