Regulatory Motifs. Contents Biology of regulatory motifs Experimental discovery Computational discovery PSSM MEME.

Slides:



Advertisements
Similar presentations
Combined analysis of ChIP- chip data and sequence data Harbison et al. CS 466 Saurabh Sinha.
Advertisements

Bioinformatics Motif Detection Revised 27/10/06. Overview Introduction Multiple Alignments Multiple alignment based on HMM Motif Finding –Motif representation.
Bioinformatics Finding signals and motifs in DNA and proteins Expectation Maximization Algorithm MEME The Gibbs sampler Lecture 10.
Bioinformatics Dr. Aladdin HamwiehKhalid Al-shamaa Abdulqader Jighly Lecture 3 Finding Motifs Aleppo University Faculty of technical engineering.
From Pairwise to Multiple Alignment. WHATS TODAY? Multiple Sequence Alignment- CLUSTAL MOTIF search.
Identification of a Novel cis-Regulatory Element Involved in the Heat Shock Response in Caenorhabditis elegans Using Microarray Gene Expression and Computational.
From Pairwise to Multiple Alignment. WHATS TODAY? Multiple Sequence Alignment- CLUSTAL MOTIF search.
Expect value Expect value (E-value) Expected number of hits, of equivalent or better score, found by random chance in a database of the size.
Transcription factor binding motifs (part I) 10/17/07.
MOPAC: Motif-finding by Preprocessing and Agglomerative Clustering from Microarrays Thomas R. Ioerger 1 Ganesh Rajagopalan 1 Debby Siegele 2 1 Department.
Introduction to BioInformatics GCB/CIS535
Tutorial 5 Motif discovery.
Sequence Motifs. Motifs Motifs represent a short common sequence –Regulatory motifs (TF binding sites) –Functional site in proteins (DNA binding motif)
An analysis of “Alignments anchored on genomic landmarks can aid in the identification of regulatory elements” by Kannan Tharakaraman et al. Sarah Aerni.
Introduction to Bioinformatics - Tutorial no. 5 MEME – Discovering motifs in sequences MAST – Searching for motifs in databanks TRANSFAC – The Transcription.
CisGreedy Motif Finder for Cistematic Sarah Aerni Mentors: Ali Mortazavi Barbara Wold.
Biological Sequence Pattern Analysis Liangjiang (LJ) Wang March 8, 2005 PLPTH 890 Introduction to Genomic Bioinformatics Lecture 16.
Computational Biology, Part 2 Representing and Finding Sequence Features using Consensus Sequences Robert F. Murphy Copyright  All rights reserved.
Ab initio motif finding
Finding Regulatory Motifs in DNA Sequences
Cis-regultory module 10/24/07. TFs often work synergistically (Harbison 2004)
Modeling Regulatory Motifs 3/26/2013. Transcriptional Regulation  Transcription is controlled by the interaction of tran-acting elements called transcription.
Motif finding : Lecture 2 CS 498 CXZ. Recap Problem 1: Given a motif, finding its instances Problem 2: Finding motif ab initio. –Paradigm: look for over-represented.
Motif finding: Lecture 1 CS 498 CXZ. From DNA to Protein: In words 1.DNA = nucleotide sequence Alphabet size = 4 (A,C,G,T) 2.DNA  mRNA (single stranded)
A Statistical Method for Finding Transcriptional Factor Binding Sites Authors: Saurabh Sinha and Martin Tompa Presenter: Christopher Schlosberg CS598ss.
Cis-regulatory element study in transcriptome Jin Chen CSE Fall
Guiding Motif Discovery by Iterative Pattern Refinement Zhiping Wang, Mehmet Dalkilic, Sun Kim School of Informatics, Indiana University.
Analyzing transcription modules in the pathogenic yeast Candida albicans Elik Chapnik Yoav Amiram Supervisor: Dr. Naama Barkai.
Detecting binding sites for transcription factors by correlating sequence data with expression. Erik Aurell Adam Ameur Jakub Orzechowski Westholm in collaboration.
Scoring Matrices Scoring matrices, PSSMs, and HMMs BIO520 BioinformaticsJim Lund Reading: Ch 6.1.
Expectation Maximization and Gibbs Sampling – Algorithms for Computational Biology Lecture 1- Introduction Lecture 2- Hashing and BLAST Lecture 3-
* only 17% of SNPs implicated in freshwater adaptation map to coding sequences Many, many mapping studies find prevalent noncoding QTLs.
CSCE555 Bioinformatics Lecture 10 Motif Discovery Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:
Motif Finding PSSMs Expectation Maximization Gibbs Sampling.
ChIP-on-Chip and Differential Location Analysis Junguk Hur School of Informatics October 4, 2005.
Sequence analysis – an overview A.Krishnamachari
Motif finding with Gibbs sampling CS 466 Saurabh Sinha.
Using Mixed Length Training Sequences in Transcription Factor Binding Site Detection Tools Nathan Snyder Carnegie Mellon University BioGrid REU 2009 University.
Motif discovery Tutorial 5. Motif discovery MEME Creates motif PSSM de-novo (unknown motif) MAST Searches for a PSSM in a DB TOMTOM Searches for a PSSM.
Construction of Substitution Matrices
CS5263 Bioinformatics Lecture 20 Practical issues in motif finding Final project.
PreDetector : Prokaryotic Regulatory Element Detector Samuel Hiard 1, Sébastien Rigali 2, Séverine Colson 2, Raphaël Marée 1 and Louis Wehenkel 1 1 Department.
Function preserves sequences Christophe Roos - MediCel ltd Similarity is a tool in understanding the information in a sequence.
Motifs BCH364C/391L Systems Biology / Bioinformatics – Spring 2015 Edward Marcotte, Univ of Texas at Austin Edward Marcotte/Univ. of Texas/BCH364C-391L/Spring.
HMMs for alignments & Sequence pattern discovery I519 Introduction to Bioinformatics.
Bioinformatics Ayesha M. Khan 9 th April, What’s in a secondary database?  It should be noted that within multiple alignments can be found conserved.
Computational Genomics and Proteomics Lecture 8 Motif Discovery C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E.
Pattern Matching Rhys Price Jones Anne R. Haake. What is pattern matching? Pattern matching is the procedure of scanning a nucleic acid or protein sequence.
Motif discovery and Protein Databases Tutorial 5.
MEME homework: probability of finding GAGTCA at a given position in the yeast genome, based on a background model of A = 0.3, T = 0.3, G = 0.2, C = 0.2.
Data Mining the Yeast Genome Expression and Sequence Data Alvis Brazma European Bioinformatics Institute.
Local Multiple Sequence Alignment Sequence Motifs
Learning Sequence Motifs Using Expectation Maximization (EM) and Gibbs Sampling BMI/CS 776 Mark Craven
. Finding Motifs in Promoter Regions Libi Hertzberg Or Zuk.
Sequence Alignment.
Construction of Substitution matrices
Motif Search and RNA Structure Prediction Lesson 9.
Special Topics in Genomics Motif Analysis. Sequence motif – a pattern of nucleotide or amino acid sequences GTATGTACTTACTATGGGTGGTCAACAAATCTATGTATGA TAACATGTGACTCCTATAACCTCTTTGGGTGGTACATGAA.
Intro to Probabilistic Models PSSMs Computational Genomics, Lecture 6b Partially based on slides by Metsada Pasmanik-Chor.
Introduction to Bioinformatics - Tutorial no. 5 MEME – Discovering motifs in sequences MAST – Searching for motifs in databanks TRANSFAC – the Transcription.
Transcription factor binding motifs (part II) 10/22/07.
Finding Motifs Vasileios Hatzivassiloglou University of Texas at Dallas.
A Very Basic Gibbs Sampler for Motif Detection
Learning Sequence Motif Models Using Expectation Maximization (EM)
Recitation 7 2/4/09 PSSMs+Gene finding
Introduction to Bioinformatics II
Finding regulatory modules
Nora Pierstorff Dept. of Genetics University of Cologne
Basic Local Alignment Search Tool
Motifs BCH339N Systems Biology / Bioinformatics – Spring 2016
Presentation transcript:

Regulatory Motifs

Contents Biology of regulatory motifs Experimental discovery Computational discovery PSSM MEME

What Makes Regulatory Motifs Important? The DNA sequence in every cell of an individual is identical. The regulation mechanism makes the difference- determines which genes are transcribed and under which conditions. One of the most heavily regulated processes in the cell is gene transcription. The major regulation point within the transcription process is the regulation of transcription initiation, regulated by Transcription Factors (TFs).

Transcription Factors & Regulatory Motifs TFs are proteins that bind to short DNA sequences, named regulatory motifs. TFs may act as: activators - upon binding enable the transcription of the neighboring gene. repressors -upon binding prevent transcription. May have a different effect on different genes. Regulatory motifs are typically 6-20 nucleotides long. Usually found in the vicinity of the gene they regulate, mostly upstream. Transcription Start Site SBFMCM1 Gene X

Facts There are many types of TFs. Each TF can affect many genes. Each gene may be regulated by several TFs. TFs may act in combinations. Example: Two TFs must bind the upstream region of a gene in order to activate its transcription. The regulatory motif that bind a TF is not exact; few mismatches are very common. and Challenges 1.How to represent a regulatory motif? 2.Can we identify new sites of known motifs in genome sequences? 3.Can we discover new motifs within upstream sequences of genes?

1. Motif Representation Exact motif: AACTTG Consensus: represent only deterministic nucleotides. Example: HAP1 binding sites in 5 sequences. CGGATATACCGG CGGTGATAGCGG CGGTACTAACGG CGGCGGTAACGG CGGCCCTAACGG CGGNNNTANCGG <- HAP1 consensus motif N – stands for any nucleotide. Representing consensus only, loses information. How can this be avoided?

PSPM – Position Specific Probability Matrix Represents a motif of length k as a family of k-mers. Defines P i (A,C,G,T) for i={1,..,k} based on the frequency of each nucleotide in each position. Each k-mer is assigned a probability. Example: P(TCCAG)=0.5*0.25*0.8*0.7*0.2 What is the consensus? A C T G

Graphical Representation – Sequence Logo Horizontal axis: position of the base in the sequence. Vertical axis: amount of information. Letter stack: order indicates importance. Letter height: indicates frequency. Consensus can be read across the top of the letter columns.

2. Identification of Known Motifs within Genomic Sequences The known motif binds a known TF. Searching for new binding sites will enable the identification of new genes controlled by the same TF. Can hint of the function of these genes; enable better understanding of the regulation mechanism. Can be achieved experimentally or computationally.

Experimental Identification Experimental methods include location analysis, mutations in the motif region, and more. These methods require a-priori knowledge of either the motif, or its location in the DNA sequence, or of the regulatory protein that binds to it. Experimental identification of an unknown regulatory motif without such prior knowledge is currently not possible.

Detecting a Known Motif within a Sequence using PSPM The PSPM is moved along the query sequence, 1 position at a time. At each position the sub- sequence is scored for a match to the PSPM. Example: sequence = ATGCAAGTCT … Position 1: ATGCA Position 2: TGCAA A T G C A A T G C A A 0.1*0.25*0.1*0.1*0.6=1.5* *0.25*0.8*0.7*0.6= A C T G A C T G

Detecting a Known Motif within a Sequence using PSSM The position that gave the maximal score represents the best match for the motif. Is is a random match, or is it indeed an occurrence of the motif? The PSPM is turned into PSSM- odds score matrix: O i (A,C,G,T) for i={1,..,k} is the ratio between P i (A,C,G,T) for i={1,..,k} and the background frequency of each nucleotide. As O i (N) increase, the odds that N (at position i) is part of a real motif increase.

PSSM as Odds Score Matrix Assumption: the background frequency of each nucleotide is Original PSPM (Pi) Odds Matrix (Oi) Going to log scale we get an additive score. Log odds Matrix (log 2 Oi) A A A

Calculating using Log Odds Matrix Example: sequence = ATGCAAGTCT … Position 1: ATGCA =-2.7 odds= 0.15 Position 2: TGCAA =5.42 odds= A C T G

Building a PSSM Collect all known sequences that bind a certain TF. Align all sequences (using multiple sequence alignment). Compute the frequency of each nucleotide in each position (PSPM). Incorporate background frequency for each nucleotide (PSSM).

Current Results: When searching for a motif in a genome using PSSM or other methods – the motif is usually found all over the place! The motif is considered real if found in the vicinity of a gene. Checking experimentally for the binding sites of a specific TF (location analysis) – the sites that bind the motif are in some cases similar to the PSSM and sometimes not! Current thinking –TFs work in combination with other TFs.

3. Finding new Motifs We are given a group of genes, which presumably contain a common regulatory motif. We know nothing of the TF that binds to the putative motif. The problem: discover the motif.

Defining Co-regulated Sequences There are several methods to discover groups of genes that have a putative common regulator.

Defining Co-regulated Sequences 1.Genes that are co-expressed – clustered together in gene expression data. 2. Genes coding for proteins that participate in a common pathway. 3. Genes related by comparative genomics methods such as conserved operons, protein fusion, and correlated evolution. 4. Orthologous genes from multiple species (homologous sequences belonging to different species).

Computational Identification We have n DNA sequences, each of length m, and look for a regulatory motif of length k. Simple solution: Exhaustive search We search for all possible motifs of length k. There are 4 k possible motifs. Initial problems: How shall we treat inexact motifs? Assume the genome contains a lot of As (e.g., yeast). Is a k-mer that is A rich a regulatory motif?

Difficulties in Computational Identification Each motif can appear in any of m-k columns; there are (m-k) n possibilities. Noise: Mismatches are allowed, the motif is not exact. Not all sequences contain the motif. Statistical significance: k is short (6-20 nucleotides). m ranges from 10s (prokaryotes) to 1000s (eukaryotes) of nucleotides. => a random motif can appear by chance in sequences.

Computational Methods This problem has received a lot of attention from CS people. Methods include: Probabilistic methods – hidden Markov models (HMMs), expectation maximization (EM), Gibbs sampling, etc. Enumeration methods – problematic for inexact motifs of length k>10. … Current status: Problem is still open. The detection of real motifs within the best 20 putative motifs is considered success. Many tests are done on synthetic data.

Tools on the Web 1.AlignACE – Aligns nucleic Acids Conserved Elements. 2.MEME – Multiple Em for Motif Elicitation eMotif - allows to scan, make and search for motifs TRANSFAC - database on eukaryotic cis-acting regulatory DNA elements and trans-acting factors. It covers the whole range from yeast to human.

sample MEME output: example.html