ASSOCIATION OF MCP-1/CCL2 GENE POLYMORPHISM WITH ACUTE GRAFT VERSUS HOST DISEASE AFTER ALLOGENEIC HAEMATOPOIETIC STEM CELL TRANSPLANTATION Z. Ambruzova 1, B. Vidan-Jeras 3, L. Raida 2, F. Mrazek 1, M. Jeras 3, E. Faber 2, A. Stahelova 1, J. Pretnar 4, K. Indrak 2, M. Petrek 1 1 Laboratory of Immunogenomics, Dept. of Immunology, 2 Department of Haematooncology, Medical Faculty Palacky University and University Hospital Olomouc, Czech Republic, 3 Blood Transfusion Center of Slovenia, 4 Department of Haematology, University Clinical Centre Ljubljana, Slovenia Supported by Czech Govt. Funding MSM and IGA MZCR NR9099

BACKGROUND  acute graft versus host disease (aGVHD) is the most serious complication of the allogeneic haematopoietic stem cell transplantation (aHSCT) and substantially influences its outcome  chemokines are molecules implicated in the activation phase of aGVHD; they attract donor T cells activated in lymphoid tissues to the target organs which leads to the clinical manifestation of aGVHD (Wysocki 2005)  functional polymorphisms of the chemokine genes may affect migration and distribution of donor T cells in the host tissues and, therefore, might influence occurence and severity of aGVHD

MONOCYTE CHEMOATTRACTANT PROTEIN-1(MCP-1)  MCP-1 (CC chemokine ligand 2, CCL2) acts via interaction with the chemokine receptor CCR2  MCP-1 plays as a potent attractant of mononuclear cells and is implicated in the recruitment and migration of leukocytes to the sites of inflammation  variations in MCP-1 expression have been studied in many diseases associated with organ inflammation (Petrek 2002, Arakelyan 2005)

MCP-1/CCL2 GENE POLYMORPHISM  CCL2 gene is polymorphic and its genetic variants can modulate MCP-1 production  functional single nucleotide polymorphism (SNP) in distal regulatory region at position may affect the level of MCP-1 protein expression (G allele is associated with increased MCP-1 secretion in vitro) (Rovin 1999)  several studies of the impact of MCP-1 gene variants on posttransplantation outcome after organ transplantation were performed (Lacha 2005, Schröppel 2002)

AIM OF THE STUDY to investigate if there exists an association between: MCP-1/CCL2 gene polymorphism A/G occurence of acute GVHD after aHSCT

INVESTIGATED SUBJECTS Number of donor-recipient pairs 141 center Olomouc88 center Ljubljana53 Median age, years (range) Donor HLA compatibility patients 40 (17-64) identical141 donors 41 (19-69) mismatched 0 Recipient sex Donor type female 58 sibling 107 male 83 other related donor 4 Diseases unrelated 30 acute leukemia (AML, ALL) 79 Graft source chronic leukemia (CML,CLL) 25 PBSC124 NHL 14 BM 17 other 23 Acute GVHD Conditioning regimen Grade 0-I 89 non-myeloablative55 Grade II 35 myeloablative86 Grade III 8 Sex of donor and recipient Grade IV 9 male with female donor31 all others combinations110

METHODS 1. MCP-1/CCL SNP genotyping Polymerase Chain Reaction with Sequence Specific Primers (PCR-SSP) Primers designed according to the reference CCL2 gene sequence MCP A/G (rs ) Specific 1 (wild type) *A: 5´GTGGGAGGCAGACAGCTA3´ Specific 2 (mutant type) *G: 5´GTGGGAGGCAGACAGCTG3´ Constant: 5´TGAGTGTTCACATAGGCTTC3´ 2. Statistics Conformity to the Hardy-Weinberg equilibrium: Chi-square test Differences between allele and genotype frequencies: Chi- square test with Woolf-Haldane correction in cases of small numbers

RESULTS  overrepresentation of MCP *G allele among recipients with aGVHD (28%) compared to those without aGHVD (17%, p=0.03) (Table 1, Figure 1)  recipients carrying MCP *G allele developed aGVHD more frequently (50%) than MCP AA homozygous individuals (33%, p=0.04) (Figure 2)  no association between the presence of MCP alleles/genotypes in donors and development of aGVHD was found

Table 1: Genotype and allele frequencies of the MCP A/G SNP in the groups of patients with/without aGVHD Patients aGVHD+Patients aGVHD- Genotype frequency n= 52 n= 80 Genotype AA0.50 (26)0.68 (54) Genotype GA0.44 (23)0.31 (25) Genotype GG0.06 (3)0.01 (1) Allele frequencyn= 104n= 160 Allele A0.72 (75)0.83 (133) Allele G0.28 (29)0.17 (27)p = 0.03

Figure 1: MCP *G allele frequency in patients according to the presence/absence of acute GVHD p = 0.03

Figure 2: Occurence of acute GVHD in carriers/non-carriers of MCP *G allele p = 0.04

CONCLUSION Our study revealed association between MCP *G allele in recipients and aGVHD in Czech and Slovenian patients after aHSCT. This data suggest that MCP gene polymorphism may contribute to the development of acute GVHD at least in West-Slavonic populations. Replication on further cohorts / populations and data on MCP-1 expression in aGVHD may clarify real contribution of the MCP variants to the development of GVHD.

REFERENCES Arakelyan A, Petrkova J, Hermanova Z, Boyajyan A, Lukl J, Petrek M: Serum levels of the MCP-1 chemokine in patients with ischemic stroke and myocardial infarction. Mediators Inflamm 2005;3:175-9 Lacha J, Hribova P, Kotsch K, Brabcova I, Bartosova K. Volk HD, Vitko S: Effect of cytokines and chemokines (TGF-beta, TNF-alpha, IL-6, IL-10, MCP-1, RANTES) gene polymorphisms in kidney recipients on posttransplantation outcome: influence of donor-recipient match. Transplant Proc 2005; 37: Petrek M, Kolek V, Szotkowska J, du Bois RM: CC and C chemokine expression in pulmonary sarcoidosis. Eur Respir J 2002; 20: Rovin BH, Lu L, Saxena R: A novel polymorphism in the MCP-1 gene regulatory region that influences MCP-1 expression. Biochem Biophys Res Commun 1999; 259: Schröppel B, Fischereder M, Lin M, Marder B, Schiano T, Krämer BK, Murphy B: Analysis of gene polymorphisms in the regulatory region of MCP-1, RANTES and CCR5 in liver transplant recipients. J Clin Immunol 2002; 22: Wysocki CA, Panoskaltsis-Mortari A, Blazar BR, Serody JS: Leukocyte migration and graft-versus-host disease. Blood 2005; 105: