Regents Biology Turn in DNA letter Begin reading Analogy Story and answer the questions Don’t worry about the back page
Regents Biology Watch animation Ask questions if something is unclear Then we’ll take a few notes about what we discussed Tomorrow you’ll take what we learned to decode genetic instructions, find out what a fictional creature looks like based on the instructions and draw it.
Regents Biology Protein Synthesis Making Proteins
Regents Biology Bodies are made up of cells All cells run on a set of instructions spelled out in DNA Bodies Cells DNA
Regents Biology How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA Cells Bodies
Regents Biology DNA has the info to build proteins DNA Proteins Cells Bodies proteins cells bodies DNA gets all the glory, Proteins do all the work
Regents Biology How do proteins do all the work Proteins proteins run living organisms enzymes control all chemical reactions in living organisms structure all living organisms are built out of proteins
Regents Biology cytoplasm nucleus Cell organization DNA DNA is in the nucleus genes = instructions for making proteins want to keep it there = protected “locked in the vault”
Regents Biology Cell organization Proteins chains of amino acids made by a “protein factory” in cytoplasm protein factory = ribosome nucleus cytoplasm ribosome build proteins
Regents Biology Passing on DNA information Need to get DNA gene information from nucleus to ribosome The code to make protein is in DNA. Since DNA can’t leave the nucleus a copy called mRNA is made, which is sent to the ribosome to then make protein nucleus cytoplasm ribosome mRNA build proteins
Regents Biology mRNA From nucleus to cytoplasm DNA transcription nucleus cytoplasm translation trait protein
Regents Biology DNA vs. RNA DNA deoxyribose sugar nitrogen bases G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded
Regents Biology Transcription Making mRNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase
Regents Biology Matching bases of DNA & RNA Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA
Regents Biology Matching bases of DNA & RNA Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA
Regents Biology Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A
Regents Biology Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA UCCCCCCAAUGUGAAAAAGGGGUU ribosome
Regents Biology Once a copy is made in the nucleus mRNA goes to the ribosome TRANSLATION: ribosome decodes the instructions on mRNA and makes a protein
Regents Biology How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA aa How? mRNA UCCCCCCAAUGUGAAAAAGGGGUU
Regents Biology Codes are written in groups of 3 letters (codon) TAC GCA DNA AUG CGU mRNA tRNA Met tRNA Arg codon
Regents Biology mRNA to protein = Translation The working instructions mRNA The reader ribosome The transporter transfer RNA (tRNA) mRNA UCCCCCCAAUGUGAAAAAGGGGUU aa tRNA GG U aa tRNA UAC aa tRNA GA C aa AGU ribosome
Regents Biology protein transcription cytoplasm nucleus translation trait
Regents Biology Whoops! See what happens when your genes don’t work right! Any Questions??