RNA and Protein Synthesis

Slides:



Advertisements
Similar presentations
RNA and Protein Synthesis
Advertisements

CH 11.4 & 11.5 “DNA to Polypeptide”.
Translation Proteins are made by joining amino acids into long chains called polypeptides (proteins). Each polypeptide contains a combination of any or.
Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.
RNA and Protein Synthesis
RNA and Protein Synthesis
10-2: RNA and 10-3: Protein Synthesis
RNA Transcription.
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
Protein Synthesis Chapter 11.
RNA & Protein Synthesis Intro Genes code DNA instructions that control the production of proteins within the cell. Genes The first step in decoding.
Lesson Overview 13.1 RNA.
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
13.1 RNA.
02/04/15 To Do: 1.Bell Work 2.DNA to Proteins 3.Code Project 4.Complete Coded Message Bell Work: Copy To Do in Agenda. Pick up your SIN On pg. 67, create.
Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
RNA and Protein Synthesis
RNA and Protein Synthesis
RNA AND PROTEIN SYNTHESIS RNA vs DNA RNADNA 1. 5 – Carbon sugar (ribose) 5 – Carbon sugar (deoxyribose) 2. Phosphate group Phosphate group 3. Nitrogenous.
VII RNA and Protein Synthesis
Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis
By: Anne Russell, Madelyn Stroder, Hannah Black, And Bailey Mills.
The Genetic Code.
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.
Section 12-3 RNA & Protein Synthesis
Copyright Pearson Prentice Hall
RNA AND PROTEIN SYNTHESIS
Lesson Overview Lesson OverviewFermentation Lesson Overview 13.1 RNA.
RNA & Protein Synthesis
Nucleic Acids Comparing DNA and RNA. Both are made of nucleotides that contain  5-carbon sugar,  a phosphate group,  nitrogenous base.
Lesson Overview Lesson OverviewFermentation Lesson Overview 13.1 RNA.
RNA & Protein Synthesis Ribose RNA. DNARNA StructureDouble Stranded Single Stranded Bases- PurinesAdenine (A) Guanine (G) Bases - Pyrimidines Cytosine.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?
Question of the DAY Jan 14 During DNA Replication, a template strand is also known as a During DNA Replication, a template strand is also known as a A.
Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
13.1 RNA 13.2 Ribosomes & Protein Synthesis
Chapter 13 – RNA & Protein Synthesis MS. LUACES HONORS BIOLOGY.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
Gene Expression DNA, RNA, and Protein Synthesis. Gene Expression Genes contain messages that determine traits. The process of expressing those genes includes.
CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
End Show 12–3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis 106. What are genes? They are coded.
Chapter 13 From DNA to Proteins
Notes: Transcription DNA vs. RNA
RNA and Protein Synthesis
RNA & Protein synthesis
From DNA to Proteins Lesson 1.
Copyright Pearson Prentice Hall
12-3 RNA and Protein Synthesis
RNA Ribonucleic Acid.
What is RNA? Do Now: What is RNA made of?
12-3 RNA and Protein Synthesis
RNA and Protein Synthesis
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Lesson Overview 13.1 RNA
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Comparing RNA and DNA Each nucleotide in both DNA and RNA is made up of a 5-carbon sugar, a phosphate group, and a nitrogenous base. There are three important.
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Presentation transcript:

RNA and Protein Synthesis Section 12–3 This section describes RNA and its role in transcription and translation.

The Structure of RNA List the three main differences between RNA and DNA. RNA has ribose sugar instead of deoxyribose. RNA is generally single-stranded, instead of double-stranded. RNA contains uracil in place of thymine.

Purpose of RNA Is the following sentence true or false? RNA is like a disposable copy of a DNA segment. True

What is the importance of the cell’s ability to copy a single DNA sequence into RNA? It makes it possible for a single gene to produce large numbers of RNA molecules.

Types of RNA What is the one job in which most RNA molecules are involved? Most are involved in protein synthesis.

Types of RNA Complete the compare-and-contrast table about the types of RNA.

Type Function Carries copies of the instructions for assembling amino acids from DNA to the rest of the cell. Ribosomal RNA is a part of ribosomes. Transfer RNA Transfers each amino acid to the ribosome to help assemble proteins

Transcription Circle the letter of each sentence that is true about transcription. b. RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA. c. RNA polymerase binds only to DNA promoters, which have specific base sequences.

RNA Editing Many RNA molecules from eukaryotic genes have sections, called _____, edited out of them before they become functional. The remaining pieces, called, _________are spliced together. Introns Exons

RNA Editing Is the following sentence true or false? RNA editing occurs in the cytoplasm of the cell. False

RNA Editing What are two explanations for why some RNA molecules are cut and spliced? It makes it possible for a single gene to produce several different forms of RNA. It may play a role in evolution, making it possible for small changes in DNA to have dramatic effects in gene expression.

The Genetic Code Proteins are made by joining ________into long chains called polypeptides. Amino acids

The Genetic Code How can only four bases in RNA carry instructions for 20 different amino acids? The genetic code is read three letters at a time, so that each “word” of the coded message is three bases long.

The Genetic Code What is a codon? It consists of three consecutive nucleotides that specify a single amino acid that is to be added to a polypeptide.

The Genetic Code Circle the letter of the number of possible three-base codons. 4 12 c. 64 d. 128

The Genetic Code Is the following sentence true or false? All amino acids are specified by only one codon. False

The Genetic Code Circle the letter of the codon that serves as the “start” codon for protein synthesis. a.UGA b.UAA c. UAG d. AUG

Translation What occurs during the process of translation? The cell uses information from messenger RNA to produce proteins.

Where does translation take place? Translation takes place on the ribosomes.

Circle the letter of each sentence that is true about translation. Before translation occurs, messenger RNA is transcribed from DNA in the nucleus. It is the job of transfer RNA to bring the proper amino acid into the ribosome to be attached to the growing peptide chain. When the ribosome reaches a stop codon, it releases the newly formed polypeptide and the mRNA molecule.

What is an anticodon? The three bases on a tRNA molecule that are complementary to one of the mRNA codons.

The Roles of RNA and DNA Match the roles with the molecules. Roles Master plan - DNA Goes to the ribosomes in the cytoplasm - RNA Blueprint – RNA Remains in the nucleus - DNA

Genes and Proteins Many proteins are_____, which catalyze and regulate chemical reactions. Enzymes

Is the following sentence true or false? Genes are the keys to almost everything that living cells do. false

Translation Four Major Steps A. Messenger RNA is transcribed in the nucleus then enters the cytoplasm and attaches to an ribosome. B. Transfer RNA translation begins at AUG, the start codon. Each anti-codon of tRNA complements a codon of mRNA and binds a specific amino acid.

Translation Four Major Steps cont. C. The polypeptide “assembly line” as the codons bind amino acids the ribosome joins them together forming long chains of amino acids. D. Completing the Polypeptide the process continues until one of three stop codons is reached.