From Gene to Protein Chapter 17 - Campbell.

Slides:



Advertisements
Similar presentations
From Gene to Protein How Genes Work
Advertisements

Toe-Tapping Transcription and Translation From Gene to Protein... Chapter 17.
AP Biology From Gene to Protein How Genes Work.
Central Dogma Big Idea 3: Living systems store, retrieve, transmit, and respond to info essential to life processes.
1 Gene expression Transcription and Translation 2 1.Important Features a. DNA contains genetic template for proteins. b. DNA is found in the nucleus.
Gene Activity: How Genes Work
Chapter 17 AP Biology From Gene to Protein.
Protein Synthesis.
Genes and Protein Synthesis
DNA gets all the glory, but proteins do all the work!
Protein Synthesis Notes
FROM GENE TO PROTEIN: TRANSCRIPTION & RNA PROCESSING Chapter 17.
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
From Gene to Protein.
Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.
FROM DNA TO PROTEIN Transcription – Translation We will use:
From Gene to Protein Chapter 17 - Campbell What do genes code for? proteins All the traits of the body How does DNA code for cells & bodies?  how are.
AP Biology From Gene to Protein How Genes Work AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are.
AP Biology From Gene to Protein How Genes Work.
FROM DNA TO PROTEIN Transcription – Translation. I. Overview Although DNA and the genes on it are responsible for inheritance, the day to day operations.
AP Biology Lecture #33 Translation.
1 Gene expression Transcription and Translation. 2 1.Important Features: Eukaryotic cells a. DNA contains genetic template for proteins. b. DNA is found.
Chapter 17 From Gene to Protein
From Gene To Protein Chapter 17. From Gene to Protein The “Central Dogma of Molecular Biology” is DNA  RNA  protein Meaning that our DNA codes our RNA.
Chapter 17 Central Dogma of Molecular Biology From Genes to Protein One gene – one polypeptide hypothesis One gene dictates the production of a single.
From Gene to Protein How Genes Work
AP Biology Warmup 11/12 Differentiate a codon and an anitcodon. Which do you use to read the following chart?
Protein Synthesis IB Biology HL 1 Spring 2014 Mrs. Peters.
Chapter 17 From Gene to Protein. Gene Expression DNA leads to specific traits by synthesizing proteins Gene expression – the process by which DNA directs.
AP Details for Protein Synthesis 2014 From gene to protein.
Protein Synthesis Transcription and Translation. Protein Synthesis: Transcription Transcription is divided into 3 processes: –Initiation, Elongation and.
AP Biology Chapter 17. From Gene to Protein.
Gene Expression. Central Dogma Information flows from: DNA  RNA  Protein Exception: reverse transcriptase (retroviruses) RNA  DNA  RNA  Protein.
AP Biology From Gene to Protein How Genes Work.
AP Biology From Gene to Protein How Genes Work.
PROTEIN SYNTHESIS HOW GENES ARE EXPRESSED. BEADLE AND TATUM-1930’S One Gene-One Enzyme Hypothesis.
AP Biology From Gene to Protein How Genes Work AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are.
Genes and Protein Synthesis
Protein Synthesis.
Transcription and Translation The Objective : To give information about : 1- The typical structure of RNA and its function and types. 2- Differences between.
Today… Turn in Bozeman homework Complete DNA modeling activity Lecture notes on Transcription & Translation POGIL Homework assigned: read article from.
RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.
Protein Synthesis RNA, Transcription, and Translation.
From Gene to Protein Transcription and Translation.
Transcription and Translation
The Central Dogma of Life. replication. Protein Synthesis The information content of DNA is in the form of specific sequences of nucleotides along the.
From Gene to Protein proteinscellsbodies How does DNA code for cells & bodies? DNA.
 James Watson and Francis Crick worked out the three-dimensional structure of DNA, based on work by Rosalind Franklin Figure 10.3A, B.
From Gene to Protein Chapter 17. Overview of Transcription & Translation.
Gene Expression : Transcription and Translation 3.4 & 7.3.
AP Biology Chapter 17. From Gene to Protein.
FROM DNA TO PROTEIN Transcription – Translation
From Gene to Protein How Genes Work.
from nucleic acid language to amino acid language
Chapter 17: From Gene to Protein
From Genes to Protein Chapter 17.
Translation Unit 5B.4.
Ch 17 - From Gene to Protein
Gene Expression : Transcription and Translation
From Gene to Protein Chapter 17.
From Gene to Protein.
From Gene to Protein Chapter 17 - Campbell.
From Gene to Protein How Genes Work
Transcription Credit for the original presentation is given to Mrs. Boyd, Westlake High School.
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
From Gene to Protein Chapter 17 - Campbell.
GENE EXPRESSION / PROTEIN SYNTHESIS
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
From Gene to Protein Chapter 17 - Campbell.
Presentation transcript:

From Gene to Protein Chapter 17 - Campbell

What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA All the traits of the body DNA proteins

transcription and translation The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation replication

DNA RNA RNA Monomers = nucleotides Phosphate Ribose sugar Nitrogen Bases uracil instead of thymine U bonds with A C bonds with G single stranded transcription DNA RNA

Allowed to travel from nucleus to cytoplasm Compare DNA and RNA DNA RNA Shape Double helix 2 strands Single strand Sugar Deoxyribose Ribose Bases A, T, C, and G A, U, C and G Location Only in the nucleus Allowed to travel from nucleus to cytoplasm

Types of RNA Ribosomal RNA (rRNA) Transfer RNA (tRNA) Major component of ribosomes Transfer RNA (tRNA) Folded upon itself Carries the amino acids to the mRNA Messenger RNA (mRNA) Sequence of nucleotides that determines the primary sequence of the polypeptide Made in the nucleus from the DNA: transcription snRNA (small-nuclear “snurps”) Forms the “spliceosomes” which are used to cut out introns from pre-mRNA siRNA (small-interfering) targets specific mRNA and prohibits it from being expressed

Protein Synthesis: From gene to protein aa a nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

Which gene is read on the DNA? Promoter region binding site before beginning of gene Generally referred to as a TATA box because it is a repeating sequence of T and A binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene Speeds up process

Transcription Factors transcription factors bind to promoter region of DNA proteins can be activated by hormones (cell signaling) turn on or off transcription triggers the binding of RNA polymerase to DNA

Transcription: DNA to mRNA Takes place in the nucleus A section of DNA is unzipped RNA polymerase lays down nucleotides 5’ to 3’ direction. The mRNA then leaves the nucleus through the nuclear pores and enters the cytoplasm

Coding strand = this is the protein needed or “sense strand” Template strand = this is the “anti-sense strand”

Eukaryotic genes have untranscribed regions! mRNA must be modified before it leaves the nucleus exons = the real gene expressed / coding DNA introns = non-coded section in-between sequence Spliceosomes cut out introns with ribozyme introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

Starting to get hard to define a gene! Alternative splicing Same piece of DNA can be read many different Not all the exons may make it to the final product Intron presence can determine which exons stay or go Increases efficiency and flexibility of cell snRNA’s have big role in alternative splicing Starting to get hard to define a gene!

Final mRNA processing… Need to protect mRNA on its trip from nucleus to cytoplasm (enzymes in cytoplasm attack mRNA) protect the ends of the molecule add 5 GTP cap add poly-A tail longer tail, mRNA lasts longer eukaryotic RNA is about 10% of eukaryotic gene. A 3' poly-A tail mRNA 5' 5' cap 3' G P 50-250 A’s

The Transcriptional unit enhancer 1000+b translation start translation stop exons 20-30b transcriptional unit (gene) RNA polymerase 3' TAC ACT 5' TATA DNA transcription start introns transcription stop promoter DNA pre-mRNA 5' 3' mature mRNA 5' 3' GTP AAAAAAAA

Genetic Code Genetic code is based on sets of 3 nucleotides …called CODONS! Read from the mRNA 64 different possible combinations exist Only 20 amino acids commonly exist in the human body Some codons code for the same amino acids (degenerate or redundant) Sequence of codons determines the sequence of the polypeptide Code is “almost” universal…same for all organisms (evolutionary heritage)

The Code You don’t need to memorize the codons (except for AUG) Start codon AUG methionine Stop codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA ? MetArgValAsnAlaCysAla protein

How is the code “translated?” Process of reading mRNA and creating a protein chain from the code.

Ribosomes: Site of Protein Synthesis Facilitate coupling of tRNA anticodon to mRNA codon Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

Ribosomes: 3 binding sites A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) Empty tRNA leaves ribosome from exit site Met 5' U A C A U G

Transfer RNA Found in cytoplasm Carries amino acids to ribosome Contains an “anticodon” of nitrogen bases Anticodons use complementary bond with codons Less tRNA’s than codons, so one tRNA may bind with more than one codon. Supports the degenerate code “Wobble” hypothesis: anticodon with U in third position can bind to A or G

Translation: mRNA to Protein In the cytoplasm ribosomes attach to the mRNA Ribosome covers 3 codons at a time Initiation - The tRNA carrying an amino acid comes into P-site and bonds by base pairing its anti-codon with the mRNA start codon (what is the start codon?) Elongation – The second tRNA then comes into A-site and bonds to codon of mRNA The two amino acids joined with peptide bond Termination – ribosome continues reading mRNA until a STOP codon is reached (doesn’t code for anything) McGraw Hill Animations

Building a polypeptide 1 2 3 Initiation mRNA, ribosome subunits, initiator tRNA come together Elongation adding amino acids based on codons Termination STOP codon = Release factor Good Overview animation Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G C U A C 5' U A C G A C U A C G A C G A C 5' A 5' U A A U G C U G A U A U G C U G A A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

Can you tell the story? exon intron 5' GTP cap poly-A tail RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA poly-A tail large ribosomal subunit 3' polypeptide 5' tRNA small ribosomal subunit E P A ribosome

Prokaryote vs. Eukaryote Differences Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns No splicing Promoter & terminator sequence Smaller ribosomes Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns and exons TATA box promoter Transcription factors present Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise.

Protein Synthesis in Prokaryotes Transcription & translation are simultaneous in bacteria Both occur in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed