Last lecture summary

Sequencing strategies Hierarchical genome shotgun HGS – Human Genome Project “map first, sequence second” clone-by-clone … cloning is performed twice (BAC, plasmid)

Sequencing strategies Whole genome shotgun WGS – Celera shotgun, no mapping Coverage - the average number of reads representing a given nucleotide in the reconstructed sequence. HGS: 8, WGS: 20

Human genome 3 billions bps, ~20 000 – 25 000 genes Only 1.1 – 1.4 % of the genome sequence codes for proteins. State of completion: best estimate – 92.3% is complete problematic unfinished regions: centromeres, telomeres (both contain highly repetitive sequences), some unclosed gaps It is likely that the centromeres and telomeres will remain unsequenced until new technology is developed Genome is stored in databases Primary database – Genebank (http://www.ncbi.nlm.nih.gov/sites/entrez?db=nucleotide) Additional data and annotation, tools for visualizing and searching UCSCS (http://genome.ucsc.edu) Ensembl (http://www.ensembl.org)

New stuff

Personal human genomes Personal genomes had not been sequenced in the Human Genome Project to protect the identity of volunteers who provided DNA samples. Following personal genomes were available by July 2011: Japanese male (2010, PMID: 20972442) Korean male (2009, PMID: 19470904) Chinese male (2008, PMID: 18987735) Nigerian male (2008, PMID: 18987734) J. D. Watson (2008, PMID: 18421352) J. C. Venter (2007, PMID: 17803354) HGP sequence is haploid, however, the sequence maps of Venter and Watson are diploid.

Next generation sequencing (NGS) The completion of human genome was just a start of modern DNA sequencing era – “high-throughput next generation sequencing” (NGS). New approaches, reduce time and cost. Holly Grail of sequencing – complete human genome below $ 1000.

1st and 2nd generation of sequencers 1st generation – ABI Prism 3700 (Sanger, fluorescence, 96 capillaries), used in HGP and in Celera Sanger method overcomes NGS by the read length (600 bps) 2nd generation - birth of HT-NGS in 2005. 454 Life Sciences developed GS 20 sequencer. Combines PCR with pyrosequencing. Pyrosequencing – sequencing-by-synthesis Relies on detection of pyrophosphate release on nucleotide incorporation rather than chain termination with ddNTs. The release of pyrophosphate is detected by flash of light (chemiluminiscence). Average read length: 400 bp Roche GS-FLX 454 (successor of GS 20) used for J. Watson’s genome sequencing. Show video Show Pyrosequencing.flv PYROSEQUENCING - "Sequencing by synthesis" involves taking a single strand of the DNA to be sequenced and then synthesizing its complementary strand enzymatically. The pyrosequencing method is based on detecting the activity of DNA polymerase (a DNA synthesizing enzyme) with another chemiluminescent enzyme. Essentially, the method allows sequencing of a single strand of DNA by synthesizing the complementary strand along it, one base pair at a time, and detecting which base was actually added at each step. The template DNA is immobile, and solutions of A, C, G, and T nucleotides are sequentially added and removed from the reaction. Light is produced only when the nucleotide solution complements the first unpaired base of the template. The sequence of solutions which produce chemiluminescent signals allows the determination of the sequence of the template. - Based on excellent and up-to-date review Pareek CS, Smoczynski R, Tretyn A. Sequencing technologies and genome sequencing. J Appl Genet. 2011 Jun 23. PubMed PMID: 21698376

3rd generation 2nd generation still uses PCR amplification which may introduce base sequence errors or favor certain sequences over others. To overcome this, emerging 3rd generation of seqeuencers performs the single molecule sequencing (i.e. sequence is determined directly from one DNA molecule, no amplification or cloning). Compared to 2nd generation these instruments offer higher throughput, longer reads (~1000 bps), higher accuracy, small amount of starting material, lower cost

Moore’s law Na tabuli kridou kreslit a vysvetlovat Mooruv zakon a logaritmickou osu na grafu 1) Mooruv zakon – zdvojnasobeni vypocetni sily kazde dva roky. Ted je vypocetni sila n, za dva roky je 2n, za dalsi dva roky je 2*2n=4n, za dlais dva roky je 2*4n=8n, pak 16n atd. S linearni y osou je to parabola. 2) Kdyz chci, aby byly na y ose vzdalenosti mezi 2n, 4n, 8n, 16, … ekvidistantni, co musim udelat? Vzit log, protoze mam log(2n), log(4n)=log(2^2n)=2xlog(2n), log(8n)=3xlog(2n),… v logaritmicke ose pak bude Mooruv zakon primka.

transition to 2nd generation source: http://www.genome.gov/27541954 transition to 2nd generation 5,000$ 4,905 $ 0.054$

Illumina HiSeq X Ten 14. 1. 2014 Illumina anounced the new HiSeq X Ten Sequencing System. Illumina claims they are enabling the $1,000 genome. Uses Illumina SBS technology (sequencing-by-synthesis). It sells for at least $10 million.

Human Longevity 4. 3. 2014 – Human Longevity was founded by Craig Venter Its main aim: to slow down the process of ageing The largest human DNA sequencing operation in the world, capable of processing 40,000 human genomes a year. DNA data will be combined with other data on the health and body composition of the people whose DNA is sequenced, in the hope of gleaning insights into the molecular causes of aging and age-related illnesses like cancer and heart disease. Equipment: 2x Illumina Hiseq X Ten

Which genomes were sequenced? http://www.ncbi.nlm.nih.gov/sites/genome GOLD – Genomes online database (http://www.genomesonline.org/) information regarding complete and ongoing genome projects

Important genomics projects The analysis of personal genomes has demonstrated, how difficult is to draw medically or biologically relevant conclusions from individual sequences. More genomes need to be sequenced to learn how genotype correlates with phenotype. 1000 Genomes project (http://www.1000genomes.org/) started in 2009. Sequence the genomes of at least a 1000 people from around the world to create the detailed and medically useful picture of human genetic variation. 2nd generation of sequencers is used in 1000 Genomes. 10 000 Genomes will start soon.

Important genomics projects ENCODE project (ENCyclopedia Of DNA Elements, http://www.genome.gov/ENCODE/) by NHGRI identify all functional elements in the human genome sequence Defined regions of the human genome corresponding to 30Mb (1%) have been selected. These regions serve as the foundation on which to test and evaluate the effectiveness and efficiency of a diverse set of methods and technologies for finding various functional elements in human DNA.

Sequence Alignment

What is sequence alignment ? CTTTTCAAGGCTTA GGCTTATTATTGC Fragment overlaps CTTTTCAAGGCTTA GGCTATTATTGC navozeni squence alignmentu na prikladech, kdy se tento objevuje v predchozim vykladu nahore je presny overlap dole je priblizny overlap, jsou ukazana dve zarovnani, zarovnani s vlozenou mezerou je vice optimalni CTTTTCAAGGCTTA GGCT-ATTATTGC

What is sequence alignment ? CCCCATGGTGGCGGCAGGTGACAG CATGGGGGAGGATGGGGACAGTCCGG TTACCCCATGGTGGCGGCTTGGGAAACTT TGGCGGCTCGGGACAGTCGCGCATAAT CCATGGTGGTGGCTGGGGATAGTA TGAGGCAGTCGCGCATAATTCCG CCCCATGGTGGCGGCAGGTGACAG CATGGGGGAGGATGGGGACAGTCCGG TTACCCCATGGTGGCGGCTTGGGAAACTT TGGCGGCTCGGGACAGTCGCGCATAAT CCATGGTGGTGGCTGGGGATAGTA TGAGGCAGTCGCGCATAATTCCG toto je pouze demonstracni zarovnani clustering vede ke konsensualni sekvenci TTACCCCATGGTGGCGGCTGGGGACAGTCGCGCATAATTCCG consensus

Sequence alphabet Adenine A Thymine T Cytosine G Guanine C Name side chain charge at physiological pH 7.4 Name 3 letters 1 letter Positively charged side chains Arginine Arg R Histidine His H Lysine Lys K Negatively charged side chains Aspartic Acid Asp D Glutamic Acid Glu E Polar uncharged side chains Serine Ser S Threonine Thr T Asparagine Asn N Glutamine Gln Q Special Cysteine Cys C Selenocysteine Sec U Glycine Gly G Proline\ Pro P Hydrophobic side chains Alanine Ala A Leucine Leu L Isoleucine Ile I Methionine Met M Phenylalanine Phe F Tryptophan Trp W Tyrosine Tyr Y Valine Val V Adenine A Thymine T Cytosine G Guanine C

Sequence alignment Procedure of comparing sequences Point mutations – easy More difficult example However, gaps can be inserted to get something like this ACGTCTGATACGCCGTATAGTCTATCT ACGTCTGATTCGCCCTATCGTCTATCT gapless alignment ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT Gaps correspond to inserion in one sequnce, or deletion in another. (indel) Comparing two genes it is generally impossible to tell if an indel is an insertion in one gene, or a deletion in another, unless ancestry is known: ACGTCTGATACGCCGTATCGTCTATCT ACGTCTGAT---CCGTATCGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT gapped alignment insertion × deletion indel

Why align sequences – continuation The draft human genome is available Automated gene finding is possible Gene: AGTACGTATCGTATAGCGTAA What does it do? One approach: Is there a similar gene in another species? Align sequences with known genes Find the gene with the “best” match

Flavors of sequence alignment pair-wise alignment × multiple sequence alignment - párové/násobné zarovnání -

Flavors of sequence alignment global alignment × local alignment global align entire sequence stretches of sequence with the highest density of matches are aligned, generating islands of matches or subalignments in the aligned sequences - Sequences that are quite similar and approximately the same length are suitable candidates for global alignment. - Local alignments are more suitable for aligning sequences that are similar along some of their lengths but dissimilar in others, sequences that differ in length, or sequences that share a conserved region or domain. local

Evolution common ancestors wikipedia.org

Evolution of sequences The sequences are the products of molecular evolution. When sequences share a common ancestor, they tend to exhibit similarity in their sequences, structures and biological functions. DNA1 DNA2 Protein1 Protein2 - similar sequences produce similar proteins – this is probably the most powerful idea of bioinformatics because it enables us to make predictions. Often little is known about the function of new sequence from a genome sequencing program, but if similar sequences can be found in a database for which functional or structural information is available, then this can be used as the basis of a prediction of function or structure for the new sequence. Sequence similarity Similar 3D structure Similar function Similar sequences produce similar proteins However, this statement is not a rule. See Gerlt JA, Babbitt PC. Can sequence determine function? Genome Biol. 2000;1(5) PMID: 11178260

Homology During the time period, the molecular sequences undergo random changes, some of which are selected during the process of evolution. Selected sequences accumulate mutations, they diverge over time. Two sequences are homologous when they are descended from a common ancestor sequence. Traces of evolution may still remain in certain portions of the sequences to allow identification of the common ancestry. Residues performing key roles are preserved by natural selection, less crucial residues mutate more frequently.

Orhology, paralogy I Orthologs – homologous proteins from different species that possess the same function (e.g. corresponding kinases in signal transduction pathway in humans and mice) Paralogs – homologous proteins that have different function in the same species (e.g. two kinases in different signal transduction pathways of humans) However, these terms are controversially discussed: Jensen RA. Orthologs and paralogs - we need to get it right. Genome Biol. 2001;2(8), PMID: 11532207 and references therein two flavors of homology kinase: phospohorylation, transfers phosphate groups from high-energy donor molecules, such as ATP, to specific substrates

Orthology, paralogy II Orthologs – genes separated by the event of speciation Sequences are direct descendants of a common ancestor. Most likely have similar domain structure, 3D structure and biological function. Paralogs – genes separated by the event of genetic duplication Gene duplication: An extra copy of a gene. Gene duplication is a key mechanism in evolution. Once a gene is duplicated, the identical genes can undergo changes and diverge to create two different genes. http://www.globalchange.umich.edu/globalchange1/current/lectures/speciation/speciation.html

Gene duplication Unequal cross-over Entire chromosome is replicated twice This error will result in one of the daughter cells having an extra copy of the chromosome. If this cell fuses with another cell during reproduction, it may or may not result in a viable zygote. Retrotransposition Sequences of DNA are copied to RNA and then back to DNA instead of being translated into proteins resulting in extra copies of DNA being present within cell. Gene duplication is believed to play a major role in evolution; Duplications typically arise from an event termed unequal crossing-over (recombination) that occurs between misaligned homologous chromosomes during meiosis (germ cell formation). The chance of this event happening is a function of the degree of sharing of repetitive elements between two chromosomes. The recombination products of such an event are a duplication at the site of the exchange and a reciprocal deletion. Another way that gene duplication can occur is if the entire chromosome is replicated twice. This error will result in one of the daughter cells having an extra copy of the chromosome and all the extra genetic material. If this cell fuses with another cell during reproduction, it may or may not result in a viable zygote. The last way that gene duplication can occur is through retrotransposition. During retrotransposition, sequences of DNA are copied to RNA and then back to DNA instead of being translated into proteins. This results in extra copies of that DNA being present within the cell, which can rejoin with the chromosomes that are already present. Any genes found along these sequences of DNA will have been duplicated in the process.

Unequal cross-over Homologous chromosomes are misaligned during meiosis. The probability of misalignment is a function of the degree of sharing the repetitive elements. The underlying DNA sequence homology of the similar maternal and paternal chromosome pairs guides this search and eventual alignment along the entire length of each chromosome. The alignment is further mediated and cemented by a three-dimensional zipperlike structure surrounding each set of paired homologous chromosomes, the synaptonemal complex. Read more: Meiosis - Biology Encyclopedia - cells, plant, body, human, process, different, chromosomes, DNA, organs http://www.biologyreference.com/Ma-Mo/Meiosis.html#ixzz1cXdSgeg7

Comparing sequences through alignment – patterns of conservation and variation can be identified. The degree of sequence conservation in the alignment reveals evolutionary relatedness of different sequences The variation between sequences reflects the changes that have occurred during evolution in the form of substitutions and/or indels. Identifying the evolutionary relationships between sequences helps to characterize the function of unknown sequences. Protein sequence comparison can identify homologous sequences from common ancestor 1 billions year ago (BYA). DNA sequences typically only 600 MYA.