TELOMERES Dr. José María Romero Romero

TELOMERES are specialized structures at the end of all eukaryotic chromosomes. contain longthy streches of non-coding tandemly repeated sequence, (TTAGGG)n, and specific proteins. ensure chromosome stability and protect the ends from degradation and from fusing with other chromosomes. TELOMERES:

TELOMERES Normal somatic cells lose telomeric repeats with ongoing cell division. Telomere length is quite important for cells because they work as a buffer avoiding the loss of coding DNA.

TELOMERES The loss of telomeric repeats triggers replicative senescense in cells. Telomeres sequences are extraordinary highly conserved in evolution: all vertebrates have the same simple sequence repeat.

TELOMERES There is an important enzyme: TELOMERASE, active only in embryonic, proliferatice cells of renewal tissues, adult male germline and cancer cells, that is the main regulator of telomere´s length. TELOMERASE is a reverse transcriptase ( a RNA- dependent polymerase) that contains an RNA with the sequence complementary to the telomere repeat TTAGGG. RNA´s polymerase is used as the template.

TELOMERES The model for telomeres is that they are the physical ends of linear eukaryotic chromosomes that contain up to 15 Kb of non-coding tandemly repeated sequence: (TTAGGG)n, and specific proteins, and an overhang of nucleotides in the chromosome terminus.

TELOMERES DNA Chromosome 5-15kb nt DNA tandem repeat - (TTAGGG) n Model of a human telomere 5’ 3’

3´overhang T- LOOP D-LOOP AATCCCAATCCCAA TCCCAAT TTAGGGTTAGGGTTAGGGTTA 5´ 3´ TELOMERES 5´

3´overhang AATCCCAATCCCAA TCCCAAT TTAGGGTT 5´ 3´ TELOMERES 5´ 3´overhang erosion This telomere structure hasn´t stability

TELOMERES 5´ 3´ 3´overhang erosion Chromosomal destabilization is linked to malignancies Damaged chromosomes are degraded by nucleases and participate in end joining reactions that fuse two free ends.