The role of genetics in diagnosis and treatment of mood disorders Alessandro Serretti, MD, PhD Institute of Psychiatry University of Bologna Italy

Genetics of mood disorders  Is genetics important for MD?  Is genetics useful for MD diagnosys?  Is genetics important for MD treatment?  Is genetics useful for MD treatment?

Genetics of mood disorders  Is genetics important for MD?  Is genetics useful for MD diagnosys?  Is genetics important for MD treatment?  Is genetics useful for MD treatment?

Morbid Risk in Bipolar Disorder %

Morbid Risk in Major Depressive Disorder %

Genetics of mood disorders  Is genetics important for MD? Yes  Is genetics useful for MD diagnosys?  Is genetics important for MD treatment?  Is genetics useful for MD treatment?

Genetics of mood disorders  Is genetics important for MD? Yes  Is genetics useful for MD diagnosys?  Is genetics important for MD treatment?  Is genetics useful for MD treatment?

%? ?

Genetics of mood disorders  Is genetics important for MD? Yes  Is genetics useful for MD diagnosys? Not as we may think! Plasticity  Is genetics important for MD treatment?  Is genetics useful for MD treatment?

Genetics of mood disorders  Is genetics important for MD? Yes  Is genetics useful for MD diagnosys? Not as we may think! Plasticity  Is genetics important for MD treatment?  Is genetics useful for MD treatment?

diagnosis trials and errors effective treatment TODAY….

diagnosis trials and errors effective treatment TODAY…. TOMORROW…. tailor made

Genetic Variation  Unrelated individuals are (only) 99% genetically similar.  There is about a 7 million bp difference between any two non-related individuals.  Plus CNVs, epigenetics, expression controls…  This explains interindividual variability  Hair color, weight and …. disease liability, drug response.

Pharmacogenetic studies (Medline )

VARIATIONS IN DRUG RESPONSE GENE ß2-ADREN. CETP D2, D3, 5HT2 APOE4 RYANODINE PROTHROMBIN NET Her2/neu DRUG ALBUTEROL PRAVASTATIN ANTIPSYCHOTICS TACRINE HALOTHANE CONTRACEPTIVES ATOMOXETINE TRASTUZUMAB EFFECT Asthma response Atherosclerosis resp. Response-Side eff. Alzheimer resp. Malignant hyperthermia Thrombosis Response (Ramoz 2009) Efficacy/Tolerance

GENETICPOLYMORPHISMS PharmacokineticPharmacodynamic TransportersTransporters Plasma protein bindingPlasma protein binding MetabolismMetabolism ReceptorsReceptors Ion channelsIon channels EnzymesEnzymes Immune moleculesImmune molecules

u HTTLPR u SERT-STin2 u 5HT1A C-1019G u 5-HT1B u 5HT2A T102C u 5HT2A G1438A u 5HT2C u 5HT6 C267T u TPH A218C TPH2 u NET T-182C u NET G1287A u COMT u MAOA u DRD2 S311C u DRD4 VNTR u ACE I/D polymorphism u G-protein beta3 C825T u ADRB1 G1165C u CRHR1 u NOS C276T u IL-1beta C511T u DTNBP1 u FKBP5 u CLOCK Genes investigated in the short term u MDNF u DTNBP1 u nNOS u IL-1beta u APOE u MDR1P-gp u A-161T

REGULATORY VARIANT OF 5-HT TRANSPORTER A functional polymorphism in the transcriptional control region upstream of the 5-HTT coding sequence (5-HTTLPR) has been reported (Heils et al., 1996).

5-HTTLPR variants explained 7% of the variance of antidepressant efficacy

HTTLPR l variant associated with better outcome and side effects in caucasians, conflicting in asians (“flip-flop” Lin, 2007) Possibly through a complex and indirect effect Multiple effects both in normals and patients (Serretti, 2006) Further variants control its effects HTTLPR - Conclusions

HTTLPR l variant associated with better outcome in caucasians Possibly through a complex and indirect effect Multiple effects both in normals and patients (Serretti, 2006) Further variants control its effects HTTLPR - Conclusions

5-HTTLPR variations…… Broad influence of a single gene on a range of aspects Temperament Stress reactivity Anatomical change Mood disorders Response to antidepressants Poor serotonin pathway plasticity

Harro J (2009): The brain prepared to become anxious: predisposing neurobiology in animals and humans. Eur. Neuropsychopharm. 19:S113.

HTTLPR l variant associated with better outcome in caucasians Possibly through a complex and indirect effect Multiple effects both in normals and patients (Serretti et al., Curr Drug Targ, 2006) Further variants control its effects HTTLPR - Conclusions

 16-A  16-D  16-F tgcacccccagcatcccccc tgcacccccggcatcccccc tgcactcccagcatcccccc Types of 16th repeat (*l) Nakamura, 2000; Goldman, 2004

Studies with at least two independent replications

(Binder et al., 2004)FKBP5 Assoc. with resp. in 2 indep. samples (Tsai et al., 2007)FKBP5No association (van Rossum et al., 2006)NR3Cl ER22/23EK Associated with response (Papiol et al., 2007)FKBP5rs trend with response (p=0.09) (Lekman et al., 2008)FKBP5rs Assoc with remission (Kirchheiner et al., 2008)FKBP5rs and rs associated with response (venlafaxine and drug combination) FKBP5

BDNF

Dysbindin Studies with at least two independent replications

Dysbindin associated with SSRI antidepressant efficacy

DTNBP1 haplotype analysis for rs , rs and rs , on final MADRS covariated for baseline scores (haplotypes frequency>1%) P=

DYSBINDIN GENE (DTNBP1) IN mood disorders: ASSOCIATION WITH CLINICAL RESPONSE TO SSRIs Arias, B; Serretti, A; Mandelli, L; Gastó, C; Catalán, R; Di Ronchi, D; Fañanás, L. Pharmacogenet Genomics, In Press

Two-way repeated measures ANOVA for rs760761

P-glycoprotein - MDR1 Studies with at least two independent replications

MDR1

(Paddock, 2007)GRIK4rs assoc. with remiss. p=.001 (Gau, 2007) p75 NTR S250L assoc. with response p=.039 GRIK4

u HTTLPR u SERT-STin2 u 5HT1A C-1019G u 5-HT1B u 5HT2A T102C u 5HT2A G1438A u 5HT2C u 5HT6 C267T u TPH1 A218C u TPH1 A218C TPH2 u NET T-182C u NET G1287A u COMT u MAOA u DRD2 S311C u DRD4 VNTR u ACE I/D polymorphism u G-protein beta3 C825T u ADRB1 G1165C u CRHR1 u NOS C276T u IL-1beta C511T u FKBP5 u CLOCK Genes investigated in the short term u MDNF u DTNBP1 u nNOS u IL-1beta u APOE u MDR1P-gp u GRIK4 Different target of SSRI Different Plasticity Different SSRI availability in the brain Glutamate modulation

Some gene variants influence antidepressant effects But…

Is antidepressant a unitary effect? And… Do genes influence only one behavioral feature?

CLOCK 3111T/C Broad influence of a single gene on a range of aspects Temperament Insomnia Diurnal Preference Mood fluctuations Response to antidepressants

Genetics of mood disorders  Is genetics important for MD? Yes  Is genetics useful for MD diagnosys? Not as we may think! Plasticity  Is genetics important for MD treatment? Yes  Is genetics useful for MD treatment?

Genetics of mood disorders  Is genetics important for MD? Yes  Is genetics useful for MD diagnosys? Not as we may think! Plasticity  Is genetics important for MD treatment? Yes  Is genetics useful for MD treatment? Yes, but in a complex way

Some gene variants influence antidepressant effects and other features Can we use them in everyday clinical practice?

NO

NOT YET

Pharmacogenetics: problematic issues…and possible solutions Low variance explained by polymorphisms (HTTLPR=2.8%, TPH=2.7%, Gß3=1.2%)  Other variables influence drug response: Life events, social support, temperament, hormons…and should be included in the model! Neural Network? Epigenetic factors, CNV, Splicing, Regional expression, gene interactions…should be controlled with multivariate or neural network models. Drug response may differ across episodes…longer follow up

Would be the puzzle the actual image of reality? adherence - compliance social support stressful events personality Epigenetic factors gene interactions HormonsHormons GenomicsGenomics ProteomicsProteomics

Kansai Medical University, Japan Prof. Toshihiko Kinoshita Masaki Kato MD The Catholic University of Korea College of Medicine, South Korea Prof. Chi-Un Pae Universitat de Barcelona, Spain Prof. Lourdes Fananas Barbara Arias PhD Univerza V Ljubljani - University Of Ljubljana, Slovenia Prof. Vita Dolzan Principal Collaborating Centers Athens University, Greece Prof. Yoannis Liappas Antonis Politis MD Petros Malitas MD University of Toronto, Canada Prof. Jim Kennedy Daniel Muller MD Ludwig-Maximilians-Universität München, Germany Prof. Dan Rujescu Ina Giegling PsyD

Psychiatric Genetic Unit, Institute of Psychiatry, University of Bologna, Italy Alessandro Serretti MD PhDLaura Mandelli PsyD Raffaella Calati PsyD, PhD Sara Gibiino Diana De Ronchi MD PhD Antonio Drago MD Alberto Chiesa MD Martina Forlani