1 The Lac Operon 1961, Jacob and Monod E. coli and other bacteria Bacterial Genes Many genes constitutively expressed “housekeeping” genes Other genes are more regulated Can be turned on, or off depending on cell needs

HOUSEKEEPING GENES actin, beta (ACTB) glyceraldehyde-3-phosphate dehydrogenase ribosomal protein S27a H2B histone family, member L ATP synthase eukaryotic translation initiation factor 3, subunit 8 nascent-polypeptide-associated complex alpha polypeptide adenosine deaminase E2F transcription factor 4 2

REGULATED GENES Insulin receptor Methylation enzymes Digestive enzymes Neurotransmitters Transcription factors Hormone genes 3

Operon group of coordinately regulated genes 1 promoter for a number of genes Polycistronic mRNA Inducer molecule – turns operon on 4

5 E. Coli Lac Operon E. coli cells normally grown in glucose BUT, if lactose is used instead:  convert lactose to glucose and galactose

6 The Lac Operon allows for coordinate gene expression Note: 1 mRNA, promoter, 3 genes

7 THE OPERON HAS A. 3 STUCTURAL GENES = Z, Y, A

Lac Z gene encodes betagalactosidase b-gal lactose  glucose + galactose substrateproducts No lactose present  ~ 3 molecules of bgal Add lactose  3,000 molecules of bgal 8

9 So………………….. b- gal is an inducible enzyme What is the role of lactose? inducer

10 Lac Operon B. promoter = allows transcription of ZYA C. operator = must be unbound for P to be “open” What molecule are ALL of the components above?

11 Lac Y gene encodes permease that transports lactose into cell Lac A encodes a transacetylase

12 D. Lac I gene Encodes a repressor protein Repressor binds to operator

13 Is this operon ON or OFF? Is lactose PRESENT or ABSENT?

14 Which components act in cis? In trans?

15 Regulation of the Lac Operon Its normally repressed! = OFF Because lactose is absent Therefore, it is an inducible operon When lactose is present

INDUCER (LACTOSE SUGAR) 1. Lactose enters cell 16

2. Binds repressor protein causing conformational change 17

3. repressor cannot bind operator 18

4. RNA polymerase transcribes genes 5. Cell metabolizes lactose 19

20 Lactose (the inducer) enters the cell Binds repressor protein causing a conformational change

21 repressor binds operator polymerase cannot bind promoter no transcription of ZYA genes No lactose:

22 Why study the lac operon? “The lac operon is one of the most basic examples of gene regulation. Gene regulation is an important area of study in medicine as many diseases and conditions are as a result of deficiencies in gene regulation. Cancer is one such disease that results in the inability of a cell to control the genes that regulate its growth. Many systems of gene regulation in humans are quite complex and not understood by biologists and researchers. In studying simple models of gene regulation, we hope to perhaps gain some insight into how more complex gene regulatory systems work.”

Lac operon animation 23

Promoter region of the operon GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA LACZ CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT

25 Operon mutants Mutant Mutant Phenotype lac I - constitutive expression because …

26 This operon is not inducible

Mutant Mutant Phenotype O c constitutive expression because … 27

Mutant Mutant Phenotype P- operon always off because…… 28

Mutantphenotype Z - operon is? 29

30 Operon on, or off in the absence of lactose? Lac O c I + P + O c Z + Y + A + In presence of lactose? Is it Inducible?

Operon on, or off in the absence of lactose? Lac I - I - P + O + Z + Y + A + In presence of lactose? Is it Inducible? 31

32 Partial diploid cells contain a plasmid F’ I + Inducible? I - P + O + Z + Y + A +

F’ I - P - Z + Y - A - I + P + O + Z - Y + A + 33 Inducible?

34 Repressor and polymerase = proteins diffusible Proteins can bind DNA act in TRANS promoter, operator, and ZYA and I = genes cannot move act in CIS Tips for plasmid analysis

Lac operon notes The lac operon is under negative control Allolactose binds to allosteric site on repressor causing shape change If both glucose and lactose are present, lac genes weakly transcribed Maximal transcription when lactose is only source cyclic AMP and a catabolite activator protein produce this effect. The concentration of cyclic AMP in E. coli is inversely proportional to the concentration of glucose: as the concentration of glucose decreases, the concentration of cyclic A When the concentration of glucose is low, cAMP accumulates in the cell. The binding of cAMP and the catabolite activator protein to the lac promoter increases transcription by enhancing the binding of RNA polymerase to the lac promoter. MP increases. Lac I gene has its own promoter Repressor is a 360 aa protein tetramer. Lac I promoter is weak, few repressor molecules in cell Super repressor binds to operator even in presence of lactose 35

Positive control of lac operon CAP binds to cAMP CAP-cAMP binds to CAP site upstream of promoter CAP recruits RNA pol With glucose: + lactose Glucose preferentially used Catabolite repression because glucose reduces levels of cAMP Lac operon at low levels 36