Identification of a Mammalian Homolog to Amphibian Allurin, a Sperm Chemoattractant Zachary Harrison, Deborah D. Ricker, Ph.D., and Jeffrey P. Thompson, Ph.D. Department of Biological Sciences, York College of Pennsylvania INTRODUCTION Chemoattractants and their function on the molecular level are highly understood in invertebrates (Xiang et al. 2004). Allurin is the first chemoattractant identified in vertebrates and is located in the oviduct and on the egg jelly (Figure 1) of Xenopus laevis (Olson et al. 2001). Allurin is a member of the cysteine rich secretory protein (CRISP) super family found primarily in the mammalian male reproductive tract. Allurin is the first CRISP member to be found in any female reproductive tract. Previous studies have shown mammalian follicular fluid exhibits chemoattractant behavior (Figure 2) but no specific factor has been identified. OBJECTIVES To explore the existence of an allurin homolog in the female mouse (Mus musculus) reproductive tract using RT-PCR primers previously used to isolate amphibian allurin. To explore possible tissue-specific expression of the mouse allurin homolog. To amplify and sequence any possible PCR products and compare them to amphibian allurin. DISCUSSION The results of this study support the hypothesis that a sequence homologous to amphibian allurin was isolated in the oviduct of a mouse using amphibian allurin primers. The sequenced product was 237bp and a BLAST comparison against the mouse genome revealed 99% homology to ubiquitin conjugating enzyme(E2K). E2K uses cysteine residues to bind proteins while marking them for degradation via proteosomes (Howard et al. 2007). Ubiquitin conjugating enzyme has been shown to be involved in gametogensis (Baarends et al. 1999). Of the tissues tested, E2K was found solely in the mouse oviduct and has been found on the surface of in vitro fertilized eggs (Shibata et al. 2000). E2K could play multiple roles in the mouse oviduct, including marking proteins for degradation. E2K’s role in protein processing could aid in mouse gamete interactions similar to the role of allurin in amphibian fertilization. ACKNOWLEDGEMENTS I would like to thank Dr. Ricker and Dr. Thompson for their ongoing support of this project and overall guidance. LITERATURE CITED Xiang, X., Burnett, L. et al The sperm chemoattractant “allurin” is expressed and secreted from the Xenopus oviduct in a hormone regulated manner. Developmental Biology [serial online] 275: Available from: Science Direct. Olson, J. H., Xiang, X., et al Allurin, a 21-kDa sperm chemoattractant from Xenopus egg jelly, is related to mammalian sperm-binding proteins. Proceedings of the National Academy of Sciences [serial online] 98: Available from: EBSCO Host. Howard, R., Sharma, P., Hajjar, C., et al Ubiquitin conjugating enzymes participate in polyglutamine protein agregation. BMC Cell Biology 8: 32. Baarends, W., Roest, H., & Grootegoed, J The ubiquitin system in gametogenesis. Molecular and Cellular Endrocrinology 151:5-16. Shibata, K., Itoh, M., Aizawa, K, Sumiharu, N., et al RIKEN Integrated Sequence Analysis(RISA) System—384-Format Sequencing Pipeline with 384 Multicapillary Sequencer. Genome Res. 10: FUTURE STUDIES To test mouse ubiquitin conjugating enzyme for chemoattractive activity in vitro To locate E2K’s exact cellular position in the mouse oviduct using in situ hybridization Figure 2: Mouse sperm attracted to an ovum. ( Figure 1: Ciliated epithelium (CE) lining the amphibian oviduct depositing allurin (red stain) on the jelly layer (J1) of an egg (Olson et al. 2001). HYPOTHESIS H 1 : A sequence homologous to amphibian allurin will be isolated in the mouse (Mus musculus) oviduct using the amphibian allurin primers. H 0 : No homologous sequences will be observed in any mouse tissue samples using the amphibian allurin primers. METHODS Optimized PCR Female mice Ovary, Uterus, Oviduct, Muscle, and Kidney Dissected; RNA isolated RT-PCR using amphibian primers (Olson et al., 2001) FWD 5’TTCGTGGTATAATGAAAGAT3’ REV 5’CGCGCGTTTTTTTTTTTTTTT3’ Gel Electrophoresis of RT-PCR products; Band Extraction Ligation of PCR product into pDrive cloning vector Transformation of E. coli Cloning Vector Purification Nucleotide Sequencing; BLAST comparison Pilot study completed in BIO356 Purification of Extracted Band RESULTS Figure 3: Agarose gel of RT-PCR samples showing the product of interest in the mouse oviduct at 300 base pairs. No products were observed in the other tissue samples. Molecular weight standard in base pairs is also displayed (MW). M.W. Ovary Oviduct Uterus Kidney Muscle Product of Interest Figure 4: Oviduct PCR product from an optimized annealing temperature. This PCR product was used for ligation into pDrive Cloning Vector. Molecular weight standard in base pairs is also displayed (MW). M.W. Oviduct RT-PCR revealed a 300bp product exclusively in the mouse oviduct (Figures 3 & 4). Figure 5: pDrive cloning vector used to transform E. coli. Purified PCR product was ligated at the ‘U’ sites of the plasmid and successful transformations interrupt the P lac pathway. Figure 6: Transformed E. coli on IPTG, X-gal,and kanamycin agar plates. Successfully transformed colonies ( +) are white in color whereas untransformed colonies are blue ( - ). The 300bp product was successfully cloned into a pDrive vector (Figure 5) and used to transform E. coli (Figure 6) Figure 7: Electropherogram of the isolated nucleotide sequence. Sequence of interest was from point 41 thru 278. Other nucleotides are a part of the cloning vector. Figure 8: BLAST comparison of isolated sequence (query) to mouse genome (sbjct), ubiquitin conjugating enzyme. Horizontal lines between the two sequences confirm nucleotide homology. The vector was purified from colonies and sequencing revealed homology to ubiquitin conjugating enzyme (Figure 7 & 8). + - Product of Interest