The Good, the bad and the ugly of Genetic Engineering

Genetic engineering is the human manipulation of the DNA code of an organism in order to: –Make transgenic organisms –Clone an organism –Perform Gene therapy

Transgenic Organisms Organisms which express a gene from another organism Insert gene of interest into another organism, receiving organism now makes the protein from that gene

Practical applications Plants with “insecticide” genes Cows with extra copies of growth hormones Insulin making bacteria And most importantly…… (haha)

Practical applications? Cool Glow-in-the-dark Mice!!

Going back to the insulin made by bacteria Diabetes: dysfunctional Insulin gene; no or low amounts of insulin protein made – we can force bacteria to make insulin for us

Bacteria have circular pieces of DNA called Plasmids They can replicate, transcribe and translate any genes on the plasmid

In plasmids there are also specific sequences called restriction sites restriction site

Restriction enzymes recognize the sites and cut the DNA at that site

Each restriction enzyme recognizes and cuts a different sequence Examples: Rest. EnzymeRest. Site EcoRIGAATTC Hind IIIAAGCTT BamH1GGATCC

Restriction enzymes recognize the sites and cut one strand of the DNA at that site CACCTAGCTA G AATTC GACTAGCGAT GTGGATCGAT CTTAA G CTGATCGCTA

How many pieces do you get? CACCTAGCTA G AATTC GACTAGCGAT GTGGATCGAT CTTAA G CTGATCGCTA CACCTAGCTA GAATTC GACTAGCGAT GTGGATCGAT CTTAAG CTGATCGCTA

CACCTAGCTA G AATTC GACTAGCGAT GTGGATCGAT CTTAA G CTGATCGCTA Single stranded ends are “sticky” –Want to bind to complimentary bases

We can take advantage of this and insert any gene we want into the breaks Example: The Insulin gene insulin

What enzyme can we use to “seal the gaps” between plasmid DNA and insulin DNA? insulin

Put plasmid back into bacteria (a process called transformation) Bacteria will transcribe and translate our insulin gene even though the insulin protein doesn’t do anything for a bacterial cell. Then we can take out the insulin protein and use it to treat diabetics.

Same basic procedure, many different transgenics! Giving cows extra copies of the growth hormone gene Giving plants the gene that insects have to ward off other enemy insects Giving mice the gene that jelly fish use to fluoresce

Cloning Creating an organism that is genetically identical to its parent.

Cloning Mammals usually fuse info from two parents (sexual reproduction) Cloning takes all the chromosomes from 1 parent.

Sheep 1 Take 1 body cell (udder) Extract Nucleus Sheep 2 Take 1 egg cell Remove nucleus

Inject nucleus into Egg Zap to stimulate cell division Implant embryo into surrogate sheep (sheep 3)

Wait for Dolly to be born Which sheep is Dolly identical to?? Why? Which sheep have to be female?

Snuppy

Human Genome project What it did do: Tell us each an every nucleotide of the human genome (all 3.2 billion) What it did not do: Tell us what it all means!!!

Human Genome project Now we have to break it down and determine: - which pieces are genes - which pieces are junk - what info the genes hold.

DNA finger printing Used to compare two people’s DNA Used in paternity cases Used for crime scene analysis

DNA finger printing

Based on the idea that EVERYONE’s DNA is unique, like a fingerprint BUT related individuals will have more similarities

How to do a DNA fingerprint Get a sample of DNA and digest it with restriction enzymes

How to do a DNA fingerprint If everyone’s DNA is unique, the enzyme will cut each persons DNA differently Example: TCATGAATTCATTGCCGAATTCCGTGAATCCAGAATTCGGACTA TCATGAAGTCATTGCCGAATTCCGTGAATCCAGACTTCGGACTA

How to do a DNA fingerprint Run cut up DNA on through electrophoresis Click here for animationhere

How to do a DNA fingerprint Small pieces travel fast and move further down the gel slab. Large pieces move slower and stay closer to the injection point.

Gene Therapy Taking genetic testing one step further Gene therapy tries to FIX the genetic problem

How do we fix a gene? Take a virus that naturally infects the type of cells that are deffective.

How do we fix a gene? Remove all the virus’s DNA. Replace it with correct copy of deffective gene

Possibilities? 1.Cystic fibrosis 2.Hemophilia 3.Cancer