The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.

Slides:

Advertisements

Similar presentations

Chr9 A ntonio Granell IBMCP-Valencia Spain Tomato Sequencing, Madison July 2006.

Advertisements

Progress on the sequencing of the euchromatic gene rich space of chromosome 6 of Solanum lycopersicum cv. Heinz 1706 Sander Peters Cologne Oct 2008.

The International Tomato Sequencing Project: The first Cornerstone of the SOL Project Lukas Mueller on behalf of International SOL Tomato Sequencing Project.

US Tomato sequencing project update January 14, 2007.

9 Genomics and Beyond Brief Chapter Outline

PAA / Solanaceae July 23-27, Madison, Wisconsin, USA Sequencing the gene-rich space of tomato chromosome 7 Current status of the French effort.

Sequencing Status of the Chromosome 8 and New Marker Development toward a Genetic Map Construction between Micro-Tom and Ailsa Craig SOL Genomics Workshop.

1 Sequencing Workshop Koln, October 15, 2008 Toni Granell My apologies for not being here Thanks Joyce Chr9 sequencing update Spain.

Sequencing Tomato Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 Antonio Granell IBMCP, Valencia.

Expanding the Tool Kit for BAC Extension Summary of completion criteria developed for NSF Tomato Sequencing Workshop January 14, 2007.

Use of FISH in sequencing tomato chromosome 6 René Klein Lankhorst Hans de Jong Korea meeting 2007.

Tomato Chromosome 8 sequencing at Kazusa DNA Research Institute Erika Asamizu.

Genome sequencing. Vocabulary Bac: Bacterial Artificial Chromosome: cloning vector for yeast Pac, cosmid, fosmid, plasmid: cloning vectors for E. coli.

Today’s Lecture Genetic mapping studies: two approaches

EU-SOL 2008 November 13-16, Toulouse, FRANCE CHROMOSOME 7 SEQUENCING Current status and perspective TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497.

SOL Genomics Network Formed in 2003 to answer two questions: – How can a common set of genes give rise to such a wide range of morphologically and ecologically.

Chromosome 8 Sequencing: Current Status and Future Prospects toward Finishing Shusei Sato, Erika Asamizu, Takakazu Kaneko, Hiroyuki Fukuoka, Satoshi Tabata.

Tomato Chromosome 4: A Mapping & Sequencing Update 28 th September 2005 Christine Nicholson Mapping Core Group Welcome Trust Sanger Institute, UK.

Update tomato chr. 6 Roeland van Ham Centre for BioSystems Genomics The Netherlands.

Genomics BIT 220 Chapter 21.

SOL 2008 October 12-16, Cologne, Germany CHROMOSOME 7 THE FRENCH CONTRIBUTION TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497 T0676 TM18 CT54 T0966.

Tomato Overgo Project and Seed BAC Selection Cornell Team Ying Eileen Wang, 2005 PAG.

Progress on sequencing tomato chromosome 12 Mara Ercolano.

These images illustrate results of in situ hybridization with eight tomato BACs. Putative locations for the BACs are included in the captions. All of these.

©2000 Timothy G. Standish John 15:4 4Abide in me, and I in you. As the branch cannot bear fruit of itself, except it abide in the vine; no more can ye,

Status report on gap closure of the human chromosome 5 BAC map Authentication of C5 BAC maps Map and sequence status Gap status and steps used to close.

Mapping and sequencing chromosome 6 of Solanum lycopersicum cv

Solanum lycopersicum Chromosome 4 Sequencing Update UK-SOL– Dec 2008 Wellcome Trust Medical Photographic Library.

Current Sequencing Status of Tomato Chromosome 2 PLANT GENOME RESEARCH CENTER, KRIBB, KOREA Sanghyeob Lee Sung-Hwan Jo Dal-Hoe Koo Chul-Goo Hur Hong-Seok.

4th Solanaceae Genome Workshop 2007, September 09th- 13th, Jeju Island, Korea THE FRENCH CONTRIBUTION TO THE INTERNATIONAL TOMATO GENOME SEQUENCING PROGRAM.

FINISHING WORKSHOP APRIL 2008 CHROMOSOME 7 THE FRENCH CONTRIBUTION TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497 T0676 TM18 CT54 T0966 T0731 TM15.

Restriction Fragments and Mapping Restriction Fragment Analysis – System used to compare the genes and DNA sequences between individuals in a population.

Chromosome 2 Doil Choi, Sunghwan Jo KOREA. Cytological architecture of chromosome kb/µm DAPI (4’-6-diamidino-2-phenylindole) stained pachytene chromosome.

Progress tomato chromosome 6 René Klein Lankhorst.

INDIAN INITIATIVE FOR TOMATO GENOME SEQUENCING Nagendra Singh National Research Centre on Plant Biotechnology Indian Agricultural Research Institute New.

Wageningen, April 24-25, 2008 II Tomato Finishing Workshop Chromosome 12 Update ENEA, Rome University of Naples ‘Federico II’ CRIBI and Univ. of Padua.

HeterochromatinEuchromatin Relative chromosome length Relative bivalent diameter X 1.23 X 1.00 Relative area Relative optical density.

Italy: tomato chr. 12 Country Representative: Dr. Giovanni Giuliano Maria Luisa Chiusano Maria Raffaella Ercolano University.

Solanum lycopersicum Chromosome 4 Mapping and Finishing Update SRC-UK and Wellcome Trust Sanger Institute SOL Korea – September 2007 Wellcome Trust Medical.

Lindsay A. Shearer1, Lorinda K

70 µm 0 µm International Tomato Genome Sequencing Project Mb 85.6 Mb 83.6 Mb 82.1 Mb 80.0 Mb 53.8 Mb 80.3 Mb 64.7 Mb 81.8 Mb 88.5.

13 th January 2008 Plant & Animal Genome Conference Progress with Sequencing Tomato Chromosome 4 Clare Riddle Tomato Project Group Wellcome Trust Sanger.

16 th April 2007 Christine Nicholson, Mapping Core Group Wellcome Trust Sanger Institute Tomato Chromosome 4 Mapping & Use of FPC Copyright Wellcome Trust.

26 th July 2006 Christine Nicholson, Mapping Core Group Karen McLaren, Finishing Group Leader Wellcome Trust Sanger Institute Sequencing the Gene Space.

US Contribution to the International Tomato Genome Sequencing Effort Current structure of contributions Ongoing activity summary Funding issues.

Genome Analysis. This involves finding out the: order of the bases in the DNA location of genes parts of the DNA that controls the activity of the genes.

Physical Map and Organization of Arabidopsis thaliana Chromosome 4

Restriction Fragments and Mapping

BrGSP: the Brassica 'A' genome sequencing project

Tomato Sequencing Project Meeting at SOL 2008, Oct. 15, 2008

Genomics Sequencing genomes.

Pre-genomic era: finding your own clones

Example of a common SNP in dogs

Today’s Lecture Genetic mapping studies: two approaches

BAC-Based Physical Map of the Rice Genome.

Plant & Animal Genome Conference

Development of genome sequencing infrastructure and progress toward sequencing of chromosomes 1, 10 and 11 Steve Tanksley, Cornell U Steve Stack, Colorado.

Sequencing Chromosome 2

Status of the US contribution to the international

Current Sequencing Effort of Tomato Chromosome 2 - Chromosome assembly - Finishing workshop April KRIBB/SNU, Korea.

International Tomato Genome Sequencing Project

TG216 TG438 T1112 T1355 T1328 T1428 T1962 T1414 T1497 T0676 TM18 CT54 T0966 T0731 TM15 T1347 T1257 T0848 THE FRENCH CONTRIBUTION TO THE INTERNATIONAL.

Sequencing update of tomato chromosome 3 Chinese Academy of Sciences

New Class Offering.

Tomato FISH Song-Bin Chang Suzanne Royer Lorrie Anderson Steve Stack.

Volume 1, Issue 5, Pages (September 2008)

The Role of Fluorescence in situ hybridization (FISH)

Physical mapping Physical localisation on a chromosome

Linkage, crossing over and chromosomal mapping (2).

Presentation transcript:

The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome

Short arm Centromere Long arm

Maize 1C = 2634 Mb Tomato 1C = 916 Mb Arabidopsis 1C = 157 Mb

77% of the DNA is in heterochromatin 23% of DNA is in euchromatin

77% of the DNA is in heterochromatin 23% of the DNA is in euchromatin Thus, 0.23 x 916 Mb = 211 Mb

77% of the DNA is in heterochromatin 23% of the DNA is in euchromatin Thus, 0.23 x 916 Mb = 211 Mb Arabidopsis 1C = 157 Mb

HindIII library 15 tomato genome equivalents 129,000 clones Averaging 117 kb

EXPEN 2000 MolecularLinkage Map of Tomato Chromosome 10 (SGN)

Anchor (seed) BAC LE_HBa0234C10 Probe TG285

Anchor (seed) BAC LE_HBa0234C10 Probe TG285 aatgcctaggcatgaatcttggccatc

Anchor (seed) BAC LE_HBa0234C10 Probe TG285 aatgcctaggcatgaatcttggccatc gctacgcttagaa

Seed BAC LE_HBa0234C10 Probe TG285

Seed BAC LE_HBa0234C10 Probe TG285

Seed BAC LE_HBa0234C10 Probe TG285

Seed BAC Contig LE_HBa0234C10 Probe TG285

Fluorescence in situ Hybridization (FISH) China France The Netherlands Korea Japan USA

Fluorescence in situ Hybridization (FISH) China France The Netherlands Korea Japan USA

Nick translation biotin- digoxygenin- dinitrophenol-labeled nucleotides FISH Probes BAC DNA

Hybridization mixture fold excess of unlabeled tomato Cot 100 DNA Chromosomal in situ Suppression (CISS) Hybridization

Functions of FISH in Sequencing the Tomato Genome 1. To determine the locations of anchor BACs 2. To define eu-heterochromatin borders 3. To determine distances in Mb 4. To locate problem BACs

BAC 116C14, Slide 126, Chromosome 9, Short (p) Arm % %

Pachytene Chromosome 9

Pachytene chromosome 9

Functions of FISH in Sequencing the Tomato Genome 1. To determine the locations of anchor BACs 2. To define eu-heterochromatin borders 3. To determine distances in Mb 4. To locate problem BACs

Functions of FISH in Sequencing the Tomato Genome 1. To determine the locations of anchor BACs 2. To define eu-heterochromatin borders 3. To determine distances in Mb 4. To locate problem BACs

Functions of FISH in Sequencing the Tomato Genome 1. To determine the locations of anchor BACs 2. To define eu-heterochromatin borders 3. To determine distances in Mb 4. To locate problem BACs

177 BACs FISHED RESULTS SO FAR

177 BACs FISHED 126 BACS (74%) successfully localized. RESULTS SO FAR

177 BACs FISHED 51 failed to localize because they either gave no FISH signal or there was more than one signal in spite of CISS hybridization. 126 BACS (74%) successfully localized. RESULTS SO FAR

Of 126 BACs localized 22 (17.5%) FISHed to wrong chromosomes

Of 126 BACs localized 22 (17.5%) FISHed to wrong chromosomes Of these, 11 have been checked by sequencing: 7 were overgo false positives 1 was due to a picking error 1 was due to a typographical error 2 were due to mapping errors

Of 126 BACs localized 22 (17.5%) FISHed to wrong chromosomes Of these 11 have been checked by sequencing: 7 were overgo false positives 1 were due to a picking error 1 were due to a typographical error 2 were due to mapping errors Suggesting ≤ 3% mapping errors on the EXPEN 2000 linkage map

FUTURE ACTIVITIES an increasing emphasis on defining the size of gaps in sequencing 1) within BACs, 2) between contigs, 3) between contigs and euchromatin- heterochromatin borders

Senior Personnel Undergraduates Lorrie Anderson Madeline Fujishiro Song-Bin Chang Lauren Larsen Suzanne Royer Dylan Westfall Lindsay Shearer Jessica Wu Steve Stack The Role of BAC Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome