Using Biology to Solve a Crime Who killed Mrs. Brogan?? Disclaimer: Mrs. Brogan is actually alive and well, this scenario is intended for educational purposes.

Slides:

Advertisements

Similar presentations

PACKET 11- DNA TECHNOLOGY. WHAT DO WE ALREADY KNOW ABOUT DNA?  DNA is __________ stranded  DNA is made up of four bases: ____, ____,_____, and _____.

Advertisements

DNA Techniques Lab Preparation 13-1 Manipulating Genes Genetic Engineering: You can repair genes, insert genes, excise genes or replace genes with gene.

 Like “molecular scissors,” they cut DNA  Hundreds of different ones have been isolated from hundreds of bacteria  Bacteria use them to attack viruses.

DNA Fingerprinting. Remember! The chemical structure of everyone’s DNA is the same! The only difference between people (or any other organism) is the.

C rime S cene I nvestigation. Who Ate The Cheese? Oh no! Someone ate the Queen ’ s prize Limburger cheese! Saliva samples were taken from the teeth marks.

Manipulating DNA Chapter 13, Section: 13 -2

Molecular Biology of Genes Chapters DNA Technology (not in your book)

Gel Electrophoresis Biotech I.

AP Biology More Basic Biotechnology Tools Sorting & Copying DNA.

California Science Standards #5c,d,e DNA Fingerprinting “Elementary, my dear Watson.” -Sherlock Holmes.

Copyright © by Holt, Rinehart and Winston. All rights reserved. ResourcesChapter menu DNA Identification The repeating sequences in noncoding DNA vary.

DNA FINGERPRINTS.

Aim: How do scientists identify people using DNA Fingerprinting?

DNA Fingerprinting or DNA Profiling

Biotechnology. Southern Blot/Electrophoresis Electrophoresis- separate DNA with electricity Step 1: DNA is isolated and cut with restriction enzymes –Makes.

DNA FINGERPRINTS. No two people in the world have the same DNA (except Identical twins) A majority of DNA is actually the same for all humans. About 0.10.

Advances since Watson & Crick

AP Biology More Basic Biotechnology Tools Sorting & Copying DNA.

Class Notes 1: DNA Manipulation. I. DNA manipulation A. During recent years, scientists have developed a technique to manipulate DNA, enabling them to.

Manipulation of DNA. Restriction enzymes are used to cut DNA into smaller fragments. Different restriction enzymes recognize and cut different DNA sequences.

DNA FINGERPRINTING. 1.What do you think DNA fingerprinting is? 2. What do you think DNA fingerprinting can be used for?

DNA Technology.

 DNA can be collected from any living tissue:  blood, skin, hair, urine, semen, sweat or tears.

Gel Electrophoresis A molecular biology tool. Purpose To separate and analyze/compare fragments of DNA.

(RFLP Electrophoresis)

AP Biology DNA Fingerprinting AP Biology Many uses of restriction enzymes…  Now that we can cut DNA with restriction enzymes…  we can cut.

DNA fingerprinting is not taking someone’s fingerprint. It is cutting up a DNA strand and separating them by size.

LEQ: HOW DOES DNA PROFILING WORK? 12.8 to NUCLEIC ACID PROBES  Short single strands of DNA w/ specific nucleotide sequences are created using.

DNA Profiling (DNA fingerprinting) pard/cleared.html.

More Basic Biotechnology Tools Sorting & Copying DNA.

Manipulating DNA. Scientists use their knowledge of the structure of DNA and its chemical properties to study and change DNA molecules Different techniques.

Do Now— Turn your Do Now into the front What grade do you think you earned on your final? Why? Why grade do you think you earned on the EOC (on a.

 How do we compare DNA fragments?  separate fragments by size  How do we separate DNA fragments?  run it through a gelatin  agarose  made from algae.

Biology Chapter 9 & Honors Biology Chapter 13 Frontiers Of Biotechnology.

DNA Fingerprinting. Introduction to DNA Fingerprinting Technicians in forensic labs are often asked to do DNA profiling or “fingerprinting” Restriction.

Applications & Analysis DNA Gel Electrophoresis 1.

What happens now that the DNA has been extracted?

DNA Fingerprinting Gel Electrophoresis Sometimes we comparing DNA from two or more sources. BUT it would take too long to compare all of it!

DNA and Crime. The Crime… Evidence How can we solve this TERRIBLE crime?!? What evidence is available? What can we do with it?

Aim: How do scientists identify people using DNA Fingerprinting?

Biotechnology. Bell Work 1.You want to determine if a patient with leukemia has a mutation in a certain gene. What type of technology should you use and.

DNA Forensics Bio Interpret how DNA is used for comparison and identification of organisms.

Aim: How do scientists identify people using DNA Fingerprinting?

How do scientists identify people using DNA Fingerprinting?

DNA Fingerprinting (Profiling)

Chapter 9: Biotechnology

Aim: How do scientists identify people using DNA Fingerprinting?

Aim: How do scientists identify people using DNA Fingerprinting?

DNA Forensics Bio Interpret how DNA is used for comparison and identification of organisms.

DNA Fingerprinting.

DNA Fingerprinting.

PCR and RLFP’s.

Gel Electrophoresis.

Crime Scene Investigation

Restriction Enzymes & Electrophoresis

DNA ELECTROPHORESIS OR DNA FINGERPRINTING.

How is DNA evidence used in crime investigations?

DNA Fingerprinting.

Chapter 13: Biotechnology

Overview of Chapter 9.

Chapter 7 DNA Fingerprinting.

Date: January 31th, 2017 Aim #46: How do scientists identify people using DNA Fingerprinting? HW: Daily Review of Class Notes Biotechnology Textbook.

Gene Technology Any form of studying genes, DNA, or altering genes to enhance or remove a trait; some forms allow organisms to perform new functions.

DNA Fingerprinting.

DNA Fingerprinting.

Bellringer: What does the term “biotechnology” mean?

History of DNA Fingerprinting

DNA Profiling By Derek and Blakely.

Notes: DNA Fingerprinting pg. 3-4

Presentation transcript:

Using Biology to Solve a Crime Who killed Mrs. Brogan?? Disclaimer: Mrs. Brogan is actually alive and well, this scenario is intended for educational purposes only.

Case Background Mrs. Brogan was found dead in the prep room. Mrs. Brogan was found dead in the prep room. Stab wound to the chest. Stab wound to the chest. Blood stains found on the cabinet (Blood #1) and on the floor (Blood #2). Blood stains found on the cabinet (Blood #1) and on the floor (Blood #2). Manalapan police suspect this class. Manalapan police suspect this class. Blood samples were sent to the AP biology class for analysis. Blood samples were sent to the AP biology class for analysis.

Goal Determine whose blood was left on the wall and on the cabinet. Determine whose blood was left on the wall and on the cabinet. Use DNA fingerprinting to help solve the crime! Use DNA fingerprinting to help solve the crime!

Step 1: Polymerase Chain Reaction Used to increase the amount of DNA collected at a scene. Used to increase the amount of DNA collected at a scene. Millions of copies in a few hours

Step 2: Restriction Enzymes Cut isolated DNA at specific locations to create bands of differing lengths. Cut isolated DNA at specific locations to create bands of differing lengths. TATTAACGCAACGCGCTCAGGCCAAACTTGTAT Cuts after ‘AAC’ TATTAACGCAACGCGCTCAGGCCAAACTTGTAT

Step 3: Electrophoresis Uses electrical charge to separate DNA fragments by size Uses electrical charge to separate DNA fragments by size DNA is negatively charged, runs toward pos. DNA is negatively charged, runs toward pos. Gel is a matrix Gel is a matrix Smaller fragments travel further Smaller fragments travel further Dying the gel allows us to see the different bands of DNA Dying the gel allows us to see the different bands of DNA

Fragments Size TATTAAC = 7bp GCAAC = 5bp GCGCTCAGGCCAAAC = 15bp TATTAACGCAACGCGCTCAGGCCAAACTTGTAT Run DNA on a gel

Activity 1 Draw lines on your DNA strand to represent where the restriction enzyme would cut (after ‘AAC’). 2 Count how many bases are in each new segment. 3 Draw lines on the ‘gel’ to demonstrate what the banding pattern would look like.

Which suspect’s blood was on the scene? Brogan Blood #1 Blood #2 Suspect A Suspect B 15,10,9,813,11,7,5

Conclusions Can we be 100% certain that Suspect B killed Mrs. Brogan?? Can we be 100% certain that Suspect B killed Mrs. Brogan?? Why or why not? Why or why not? Other applications Other applications Paternity testing Paternity testing HIV conformation (western blot) HIV conformation (western blot) Determining evolutionary relationships Determining evolutionary relationships