TACKLING OSTEOARTHRITIS -Research Tools At Our Disposal Mahita Kadmiel July 21, 2005

OSTEOARTHRITIS Arthritis -most common medical problem No. 1 cause of disability in America. arthron = joint itis = inflammation. arthritis = joint inflammation. osteoarthritis, is the most common form of arthritis affects nearly 21 million people in the United States

MENISCUS The Meniscus: Shock Absorber for the Knee Meniscal Tears Traumatic tears From a sudden load being applied to the meniscal tissue which is severe enough to cause the meniscal cartilage to fail and let go. Ex. Twisting injury Degenerative meniscal tears Failure of the meniscus over time. The meniscus becomes less elastic and compliant May fail with only minimal trauma Ex. Just getting down into a squat *Degenerative meniscal tears can lead to osteoarthritis*

Healthy meniscusTorn meniscus

The expression of genetic material in the meniscus dictates it

Central Dogma of Life Reverse Transcription

Proteins make a cell what it is

Proteins RNA DNA CELLS TISSUE Histology Cell Biology Biochemistry Molecular Biology Northern Blotting RT-PCR Real-Time PCR -To study gene expression Northern Blotting RT-PCR Real-Time PCR -To study gene expression Western Blotting -To detect proteins ELISA -To quantify proteins Enzyme Assays -To measure enzyme activity Western Blotting -To detect proteins ELISA -To quantify proteins Enzyme Assays -To measure enzyme activity Staining to find -if cells are dead or alive (viability) (TUMUL) Staining to find -if cells are dead or alive (viability) (TUMUL) Southern Blotting -To find copy number of genes Genome Sequencing Southern Blotting -To find copy number of genes Genome Sequencing Staining to find -how the cells look (anatomy) (TARA) Staining to find -how the cells look (anatomy) (TARA) (TUMUL, BASIA & MYSELF)

RT-PCR Real-Time PCR -To study gene expression RT-PCR Real-Time PCR -To study gene expression ELISA -To quantify proteins ELISA -To quantify proteins Tools used in our lab

Preparation of cDNA or first strand RT 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ mRNA 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ 3’ CTGGGTTAACCAGTCGATTTTTTT 5’ 1 ST strand cDNA (complementary DNA) A, T, G, C dNTPs Reverse transcriptase ……TTTTTTT 5’ Reverse Transcription Reverse Transcription

PCR : Polymerase Chain Reaction

4 copies 32 copies 16 copies 8 copies = millions of copies End of 35 cycles Reverse Transcriptase- Polymerase Chain Reaction -Exponential amplification Marker PCR products RT RNA

Real-Time PCR SYBR Green fluoresces brightly only when bound to double stranded DNA PCR products Single stranded DNA Double stranded PCR product SYBR Green Dye Ethidium Bromide

Real-Time PCR Quantitative method Most reliable for mRNA (gene) expression Small amounts of RNA required / tissue Amplification monitored by fluorescence in real-time 96 well plate

Theoretical and Ideal Practical !!!!!

SERIES OF 10-FOLD DILUTIONS Standard curve generated using serial dilution

Melting / Dissociation Curve primer dimer

E Enzyme I Immuno S Sorbent A Assay Test to find out something Protein molecule that performs a chemical reaction Attachment of antibodies L Linked Linking an enzyme to an assay/test Technique based on antigen-antibody reaction Examples: HIV tests &PGE2

Well in a microtiter plate Well with antibodies Antibody structure Well with antibodies and BSA added Well with antibodies, BSA, and test sample Well after washes with wash buffer Secondary antibody linked to an enzynme is added to the well Well after removing excess antibody Well after adding substrate Color developed due to the formation of a substrate

Other Techniques Genome Sequencing –To find out »the base composition (A, T, G, C) »The order in which the bases are arranged Northern Blotting ( mRNA expression) Southern Blotting (copy number) Western Blotting ( protein expression)

Southern / Northern Blotting

Western Blotting

iNOS IL-1 TNF NO MMP COX-2 PGE 2 (GAG) Degrades tissue Inflammatory mediators IL-1 iNOS COX-2 MMP RT-PCR PGE 2 ELISA GAG Nitrate & Nitrite Colorimetric Assays iNOS

Questions???????