Ulf Schmitz, Introduction to molecular and cell biology1 Bioinformatics Introduction to molecular and cell biology Ulf Schmitz Bioinformatics and Systems Biology Group

Ulf Schmitz, Introduction to molecular and cell biology2 Outline 1.Recommended Literature 2.What is Bioinformatics? 3.The Cell 4.Molecular Biology / Genomics 1.Genes 2.DNA 3.RNA 4.Proteins 5.Gene Expression 5.Signaling Pathways 6.Outlook next lecture

Ulf Schmitz, Introduction to molecular and cell biology3 Recommended Literature Developing Bioinformatics Computer Skills; Cynthia Gibas & Per Jambeck; O’Reilly; ISBN: New Biology for Engineers and Computer Scientists; Aydin Tözeren & Stephen W.Byers; Pearson Prentince Hall Bioengineering; ISBN: Bioinformatics: Sequence and Genome Analysis; David W. Mount; Cold Spring Harbor; ISBN: Introduction To Bioinformatics; Arthur M. Lesk; Oxford University Press ISBN:

Ulf Schmitz, Introduction to molecular and cell biology4 What is Bioinformatics?  Bioinformatics: is the development and use of computer applications for the Analysis, Interpretation, Simulation and Prediction of biological Systems and corresponding experimental methods in nature sciences.

Ulf Schmitz, Introduction to molecular and cell biology5 Bioinformatics Biology Molecular Biology MedicinePhysics Computer Science Informatics Mathematics Statistics Chemistry What is Bioinformatics?

Ulf Schmitz, Introduction to molecular and cell biology6 History of Bioinformatics Biologists were searching for algorithms to analyze and interpret their huge amount of empiric biological data As well as computer aided modeling and simulation International molecular biological databases arose to make data internationally accessible and comparable Algorithms for gene- and protein prediction where developed These efforts lead to the development of artificial neuronal networks, genetic algorithms and evolution strategies

Ulf Schmitz, Introduction to molecular and cell biology7 Bioinformatics Offers an ever more essential input to –Molecular Biology –Pharmacology (drug design) –Agriculture –Biotechnology –Clinical medicine –Anthropology –Forensic science –Chemical industries (detergent industries, etc.)

Ulf Schmitz, Introduction to molecular and cell biology8 Organism, Organ, Cell Organism Organ

Ulf Schmitz, Introduction to molecular and cell biology9 The ER modifies proteins, makes macromolecules, and transfers substances throughout the cell. Ribosome translates mRNA into a polypeptide chain (e.g., a protein). Mitochondrion manufactures adenosine triphosphate (ATP), which is used as a source of energy. The Cell circa 100 trillion (10 14 ) cells in a human organism 200 different forms of cells Nucleus only in eukaryotic cells. Contains most of the cell's genetic material.

Ulf Schmitz, Introduction to molecular and cell biology10 Molecular Biology... is the study of biology at a molecular level. The field overlaps with other areas of biology, particularly genetics and biochemistry Molecular biology concerns itself with understanding the interactions between the various systems of a cell, including the interrelationship of DNA, RNA and protein synthesis and learning how these interactions are regulated. Schematic relationship between biochemistry, genetics and molecular biology Function GenesProteins Biochemistry Molecular Biology Genetics

Ulf Schmitz, Introduction to molecular and cell biology11 Biochemistry and Genetics Biochemistry is the study of molecules (e.g. proteins). Biochemists take an organism or cell and dissect it into its molecular components, such as enzymes, lipids and DNA, and reconstitute them in test tubes (in vitro). Genetics is the study of the effect of genetic differences on organisms. Often this can be inferred by the absence of a normal component (e.g. one gene).

Ulf Schmitz, Introduction to molecular and cell biology12 From Genes to Proteins DNA mRNA Protein Gen

Ulf Schmitz, Introduction to molecular and cell biology13 The Human Genome June 2000

Ulf Schmitz, Introduction to molecular and cell biology14 DNA ~3.2 billion base pairs in every cell build the human genome genes form only 1,5% of the human genome a gene is a segment of the DNA, that encodes the constructon plan for a protein in humans there are ca. 30,000 genes only

Ulf Schmitz, Introduction to molecular and cell biology15 Chromosome Chrom.GenesBases ,203, ,315, ,411, ,610, ,967, ,740, ,431, ,908, ,505, ,480, ,978, ,464, ,151, ,311, ,114, ,995, ,691,216 A chromosome is a very long, continuous piece of DNA, which contains many genes, regulatory elements and other intervening nucleotide sequences. Chrom.GenesBases ,753, ,790, ,644, ,976, ,476,972 X ,634,166 Y23150,961,097

Ulf Schmitz, Introduction to molecular and cell biology16 Chromosome Karyogram of human female Species# of chromosomes Fruit Fly8 Human46 Rye (Roggen)14 Ape48 Guinea Pig16 Sheep54 Dove (Taube)16 Horse64 edible snail24 Chicken78 Earthworm32 Carp (Karpfen)104 Pig40 Butterflies~380 Wheat42 Fern (Farn)~1200

Ulf Schmitz, Introduction to molecular and cell biology17 DNA - Sequence.....acctc ctgtgcaaga acatgaaaca cctgtggttc ttccttctcc tggtggcagc tcccagatgg gtcctgtccc aggtgcacct gcaggagtcg ggcccaggac tggggaagcc tccagagctc aaaaccccac ttggtgacac aactcacaca tgcccacggt gcccagagcc caaatcttgt gacacacctc ccccgtgccc acggtgccca gagcccaaat cttgtgacac acctccccca tgcccacggt gcccagagcc caaatcttgt gacacacctc ccccgtgccc ccggtgccca gcacctgaac tcttgggagg accgtcagtc ttcctcttcc ccccaaaacc caaggatacc cttatgattt cccggacccc tgaggtcacg tgcgtggtgg tggacgtgag ccacgaagac cccgaggtcc agttcaagtg gtacgtggac ggcgtggagg tgcataatgc caagacaaag ctgcgggagg agcagtacaa cagcacgttc cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaacggcaa ggagtacaag tgcaaggtct ccaacaaagc aaccaagtca gcctgacctg cctggtcaaa ggcttctacc ccagcgacat cgccgtggag tgggagagca atgggcagcc ggagaacaac tacaacacca cgcctcccat gctggactcc gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg aacatcttct catgctccgt gatgcatgag gctctgcaca accgctacac gcagaagagc ctctc.....

Ulf Schmitz, Introduction to molecular and cell biology18 DNA - Deoxyribonucleic acid Deoxyribonucleic acid (DNA) forms a double stranded helix. A sugar-phosphate backbone forms the outer shell on the helix The two strands of DNA run in opposite directions. Bases face towards each other and form hydrogen bonds carries the generic instructions (genes) free Bases Cytosine - C Guanine - G Adenine - A Thymine- T complementary base pairs

Ulf Schmitz, Introduction to molecular and cell biology19 DNA - Deoxyribonucleic acid A nucleotide is an organic molecule build of three components: 1.one out of five bases (A, G, C, T and U in RNA) 2.a pentose sugar (deoxyribose in DNA or ribose in RNA) 3.and a phosphate group. Nucleoside = Nucleobase + Pentose Nucleotide = Nucleobase + Pentose + Phosphate Group free basenucleosidenucleotide Adenine (A)AdenosineAdenosine monophosphate (AMP) Guanine (G)GuanosinGuanosine monophosphate (GMP Cytosine (C)CytidinCytidine monophosphate (CMP) Thymine (T)ThymidinThymidin monophosphate (TMP)

Ulf Schmitz, Introduction to molecular and cell biology20 DNA - Deoxyribonucleic acid TMP HO OH O P O HO O O N NH CH 3 O HO OH O P O HO O NH 2 N N N N AMP Phosphate Sugar Base GMP HO OH O P O HO O NH 2 N N N NH NH 2 1´ 2´ 5´ 4´ 3´ CMP HO OH O P O HO O NH 2 N N O 1´ 2´ 5´ 4´ 3´

Ulf Schmitz, Introduction to molecular and cell biology21 DNA CGCT SSSS PPPPP PPPPP SSSS CGCT GCGA SSSS PPPPP Sugar Phosphate Backbone Base pair hydrogen bond base sugar phosphate 5´ 3´ 5´ [read as 3 prime and 5 prime] A T A T C G T A C G C G T A G C A T G C T C A T T A C G C G A T G C G C T A

Ulf Schmitz, Introduction to molecular and cell biology22 DNA - Molecule CCTAGACATTGCTTTCCCATCCTGCTACTCAATGACAGTTTCTGGTTTCACTGGG TCACTCTCATCTTGATGCACTCCCGGGCAAGAGCTAACTGAAAGGCAGCTGCGT AACACATACCA GACACAACAGTTTATCATGGGAGAGTGAATTAAACCAGGAA... DNA-sequence (Alphabet: ATGC)

Ulf Schmitz, Introduction to molecular and cell biology23 RNA – Ribonucleic acid In RNA the base Thymine (T) is replaced by Uracil (U). The other difference to DNA is that the sugar (Pentose) will be Ribose instead of Deoxiribose. Ribose has an additional hydroxyl group. Bases: Cytosine - C Guanine - G Adenine - A Uracil- U Uracil RNA transmits genetic information from DNA (via transcription) into proteins (by translation). RNA is almost exclusively found in the single-stranded form.

Ulf Schmitz, Introduction to molecular and cell biology24 RNA – Ribonucleic acid RNA plays several roles in biology: Messenger RNA (mRNA) is transcribed directly from a gene's DNA and is used to encode proteins. RNA genes are genes that encode functional RNA molecules; in contrast to mRNA, these RNA do not code for proteins. The best-known examples of RNA genes are transfer RNA (tRNA) and ribosomal RNA (rRNA). Both forms participate in the process of translation, but many others exist. RNA forms the genetic material (genomes) of some kinds of viruses. Double-stranded RNA (dsRNA) is used as the genetic material of some RNA viruses and is involved in some cellular processes, such as RNA interference.

Ulf Schmitz, Introduction to molecular and cell biology25 Proteins Proteins have a variety of roles that they must fulfil: 1.they are the enzymes that rearrange chemical bonds. 2.they carry signals to and from the outside of the cell, and within the cell. 3.they transport small molecules. 4.they form many of the cellular structures. 5.they regulate cell processes, turning them on and off and controlling their rates.

Ulf Schmitz, Introduction to molecular and cell biology26 Proteins – Amino Acids there are 20 different types of amino acids (see below). different sequences of amino acids fold into different 3-D shapes. Proteins can range from fewer than 20 to more than 5000 amino acids in length. Each protein that an organism can produce is encoded in a piece of the DNA called a “gene”. the single-celled bacterium E.coli has about 4300 different genes. Humans are believed to have about 30,000 different genes (the exact number as yet unresolved),

Ulf Schmitz, Introduction to molecular and cell biology27 Proteins – Amino Acids Protein-Sequence (Alphabet: ACDEFGHIKLMNPQRSTVWY): MENFQKVEKIGEGTYGVVY KARNKLTGEVVALKKIRLDT ETEGVPSTAIREISLLK... a typical human cell contains about 100 million proteins of about 10,000 types Name1-letter codeTriplet GlycineGGGT,GGC,GGA,GGG AlanineAGCT,GCC,GCA,GCG ValineVGTT,GTC,GTA,GTG LeucineLTTG,TTA,CTT,CTC,CTA,CTG IsoleucineIATT,ATC,ATA HistidineHCAT,CAC SerineSTCT,TCC,TCA,TCG,AGT,AGC ThreonineTACT,ACC,ACA,ACG CysteineCTGT,TGC MethionineMATG Glutamic AcidEGAA,GAG Aspartic AcidDGAT,GAC,AAT,AAC LysineKAAA,AAG ArginineRCGT,CGC,CGA,CGG,AGA,AGG AsparagineNAAT,AAC GlutamineQCAA,CAG PhenylalanineFTTT,TTC TyrosineYTAT,TAC TryptophanWTGG ProlinePCCT,CCC,CCA,CCG Terminator (Stop)*TAA,TAG,TGA

Ulf Schmitz, Introduction to molecular and cell biology28 Proteins – Amino Acids Properties of amino acids: play a role in the construction of 3-D stuctures in proteins

Ulf Schmitz, Introduction to molecular and cell biology29 Proteins Primary protein structure is the sequence of a chain of amino acids Secondary protein structure occurs when the sequence of amino acids are linked by hydrogen bonds. Tertiary protein structure occurs when certain attractions are present between alpha helices and pleated sheets. Quaternary protein structure is a protein consisting of more than one amino acid chain.

Ulf Schmitz, Introduction to molecular and cell biology30 Proteins

Ulf Schmitz, Introduction to molecular and cell biology31 Proteins - Summary DNA sequence determines protein sequence Protein sequence determines protein structure Protein structure determines protein folding and function

Ulf Schmitz, Introduction to molecular and cell biology32 Gene Expression

Ulf Schmitz, Introduction to molecular and cell biology33 Transcription

Ulf Schmitz, Introduction to molecular and cell biology34 Gene Expression - Transcription Messenger RNA (mRNA) Messenger RNA is RNA that carries information from DNA to the ribosome sites of protein synthesis in the cell. Once mRNA has been transcribed from DNA, it is exported from the nucleus into the cytoplasm, where it is bound to ribosomes and translated into protein. Non-coding RNA or "RNA genes" RNA genes (sometimes referred to as non-coding RNA or small RNA) are genes that encode RNA that is not translated into a protein. The most prominent examples of RNA genes are transfer RNA (tRNA) and ribosomal RNA (rRNA), both of which are involved in the process of translation.

Ulf Schmitz, Introduction to molecular and cell biology35 Translation

Ulf Schmitz, Introduction to molecular and cell biology36 Translation

Ulf Schmitz, Introduction to molecular and cell biology37 Translation

Ulf Schmitz, Introduction to molecular and cell biology38 Gene Expression - Translation The genetic code is made up of three letter 'words' (termed a codon) formed from a sequence of three nucleotides (e.g.. ACT, CAG, TTT). These codons can then be translated with messenger RNA and then transfer RNA, with a codon corresponding to a particular amino acid. Since there are 64 possible codons, most amino acids have more than one possible codon. There are also three 'stop' or 'nonsense' codons signifying the end of the coding region. Name1-Letter NicknameTriplet GlycineGGGT,GGC,GGA,GGG AlanineAGCT,GCC,GCA,GCG ValineVGTT,GTC,GTA,GTG LeucineLTTG,TTA,CTT,CTC,CTA,CTG IsoleucineIATT,ATC,ATA HistidineHCAT,CAC SerineSTCT,TCC,TCA,TCG,AGT,AGC ThreonineTACT,ACC,ACA,ACG CysteineCTGT,TGC MethionineMATG Glutamic AcidEGAA,GAG Aspartic AcidDGAT,GAC,AAT,AAC LysineKAAA,AAG ArginineRCGT,CGC,CGA,CGG,AGA,AGG AsparagineNAAT,AAC GlutamineQCAA,CAG PhenylalanineFTTT,TTC TyrosineYTAT,TAC TryptophanWTGG ProlinePCCT,CCC,CCA,CCG Terminator*TAA,TAG,TGA

Ulf Schmitz, Introduction to molecular and cell biology39 A gene codes for a protein CCTGAGCCAACTATTGATGAA PEPTIDEPEPTIDE CCUGAGCCAACUAUUGAUGAA

Ulf Schmitz, Introduction to molecular and cell biology40 Metabolic networks next level of the functional/organisational hierarchy Protein networks guide the biochemistry of living cells Kegg database (Japan)

Ulf Schmitz, Introduction to molecular and cell biology41 Levels of the functional/organizational hierarchy

Ulf Schmitz, Introduction to molecular and cell biology42 Outlook – coming lecture Genomics Proteomics

Ulf Schmitz, Introduction to molecular and cell biology43 Introduction to molecular and cell biology Thanks for your attention!