BIOINFORMATICS Ency Lee.

Slides:

Advertisements

Similar presentations

Classical and Modern Genetics.  “Genetics”: study of how biological information is carried from one generation to the next –Classical Laws of inheritance.

Advertisements

Bioinformatics What is bioinformatics? Why bioinformatics? The major molecular biology facts Brief history of bioinformatics Typical problems of bioinformatics:

Bioinformatics and the Engineering Library ASEE 2008 Amy Stout.

1 Genetics The Study of Biological Information. 2 Chapter Outline DNA molecules encode the biological information fundamental to all life forms DNA molecules.

. Class 1: Introduction. The Tree of Life Source: Alberts et al.

Signal Processing Problems in Genomics Mohammad Al Bataineh Illinois Institute of Technology Chicago, IL.

Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.

Data-intensive Computing: Case Study Area 1: Bioinformatics B. Ramamurthy 6/17/20151.

Bioinformatics and Phylogenetic Analysis

Biological Databases Chi-Cheng Lin, Ph.D. Associate Professor Department of Computer Science Winona State University – Rochester Center

Integration of Bioinformatics into Inquiry Based Learning by Kathleen Gabric.

Bioinformatics Student host Chris Johnston Speaker Dr Kate McCain.

Bioinformatics & LIS A brief talk for librarians, information scientists, and computer scientists about resources and collaborative opportunities with.

Molecular Biology Background. Schematic view of DNA organization in a cell.

© Wiley Publishing All Rights Reserved. Biological Sequences.

Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan.

Bioinformatics.

Development of Bioinformatics and its application on Biotechnology

CSE 6406: Bioinformatics Algorithms. Course Outline

Unit 2 – PART A Inside the Nucleus DNA Sturcture.

Molecular Biology Primer. Starting 19 th century… Cellular biology: Cell as a fundamental building block 1850s+: ``DNA’’ was discovered by Friedrich Miescher.

Introduction to Bioinformatics Yana Kortsarts References: An Introduction to Bioinformatics Algorithms bioalgorithms.info.

DNA alphabet DNA is the principal constituent of the genome. It may be regarded as a complex set of instructions for creating an organism. Four different.

National 5 Biology Course Notes Part 4 : DNA and production of

Copyright © 2010 Pearson Education Inc. Lecture 01 – Genetics & Genomics: An Introduction Based on Chapter 1 – Genetics: An introduction.

What is Genetic Research?. Genetic Research Deals with Inherited Traits DNA Isolation Use bioinformatics to Research differences in DNA Genetic researchers.

CSCI 6900/4900 Special Topics in Computer Science Automata and Formal Grammars for Bioinformatics Bioinformatics problems sequence comparison pattern/structure.

What are the parts of DNA? Vocabulary word for chapter 6.

Organizing information in the post-genomic era The rise of bioinformatics.

Chapter 11 DNA and GENES. DNA: The Molecule of Heredity DNA, the genetic material of organisms, is composed of four kinds nucleotides. A DNA molecule.

ARE THESE ALL BEARS? WHICH ONES ARE MORE CLOSELY RELATED?

A Tutorial of Sequence Matching in Oracle Haifeng Ji* and Gang Qian** * Oklahoma City Community College ** University of Central Oklahoma.

Overview of Bioinformatics 1 Module Denis Manley..

Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill

BIOLOGICAL DATABASES. BIOLOGICAL DATA Bioinformatics is the science of Storing, Extracting, Organizing, Analyzing, and Interpreting information in biological.

Bioinformatics and Computational Biology

Primary vs. Secondary Databases Primary databases are repositories of “raw” data. These are also referred to as archival databases. -This is one of the.

5.4: Genes, DNA, and Proteins 7.1.a Students know cells function similarly in all living organisms.

Integration of Bioinformatics into Inquiry Based Learning by Kathleen Gabric.

Life and Genetic Material. Defining Life Even in science there isn’t one single definition of Life Scientists try to make all living things fit into their.

From DNA to Proteins Section 2.3 BC Science Probe 9 Pages

Biotechnology and Bioinformatics: Bioinformatics Essential Idea: Bioinformatics is the use of computers to analyze sequence data in biological research.

OBJECTIVE 11 NOTES. Explain the evolutionary significance of a nearly universal genetic code.

Protein Evolution Introducing the use of Biology Workbench as a Bioinformatics Tool.

Introduction to molecular biology Data Mining Techniques.

Prepared By: Syed Khaleelulla Hussaini. Outline Proteins DNA RNA Genetics and evolution The Sequence Matching Problem RNA Sequence Matching Complexity.

Bioinformatics Overview

Research Paper on BioInformatics

Data-intensive Computing: Case Study Area 1: Bioinformatics

Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,

What is Bioinformatics?

Bioinformatics and BLAST

Genomes and Their Evolution

There are four levels of structure in proteins

Genome organization and Bioinformatics

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Bioinformatics Vicki & Joe.

Searching the Genome Brian Cain.

Genetics Refresher Guide

The Study of Biological Information

Evolution of Genomes Chapter 21.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Friday March 27, 2015 Day 1 1. Please have these Items on your desk.

9-1 DNA: the Indispensable Forensic Tool

DNA (deoxyribonucleic acid)

Notes – Genetics 1.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

BC Science Connections 10

Presentation transcript:

BIOINFORMATICS Ency Lee

What is Bioinformatics? Bioinformatics is a fast-field within the biological sciences that was developed because of the need to handle large amounts of genetic and biochemical data. Bioinformatics includes the concept of the flow of the nucleotide sequence – DNA, and its translation into molecules of life – proteins. Molecular biology provides the basis for investigating the genotype by means of bioinformatics. Bioinformatics is the use of computers to handle biological information. Bioinformatics = Biology + Computer Science

Purpose of bioinformatics Improve content and utility of databases. Develop better tools for data generation, capture, and annotation. Develop and improve tools and databases for comprehensive functional studies. Develop and improve tools for representing and analyzing sequence similarity and variation. Create mechanisms to support effective approaches for producing robust, exportable software that can be widely shared.

Outline of Bioinformatics

Sequence Analysis All of the proteins are made up of the same basic building blocks, called amino acids. When you know a DNA(deoxyribonucleic acid) sequence, you can translate it into the corresponding protein sequence by using the genetic code which is the very same way the cell itself generates a protein sequence. Cytosine For example… TCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATAC Adenine Guanine Thymine

Tools for Sequence Analysis PubMed on the NCBI Website http://www.ncbi.nlm.nih.gov/Education/ This site will be a source for data and analysis of DNA sequences, protein sequences and a variety of other data. The site is extremely organized and it allows many different kinds of studies to be performed with the data that it provides.

2. BLAST (Basic Local Alignment Search Tool) www. ncbi. nlm. nih 2. BLAST (Basic Local Alignment Search Tool) www.ncbi.nlm.nih.gov/Education/BLAST/ This tool can be used for comparison of different sequences that you would find in the database search. This can be used to compare proteins and genes depending on your goals. BLAST is based on computer algorithm system which converts biological algorithm system into Alphabet letters.

BLAST OUTLINE

3. ClustalW www.expasy.org/sprot FASTA by European Bioinformatics Institutions

Genome analysis It can determine locations of genes on chromosomes and give information on heritability and linkage to other genes. Bioinformatics tools and databases are gradually becoming an integrated system that reflects the complexity of organisms. With genome projects of small organisms being completed one by one, an understanding of the differences of genomes from the tree urkingdoms (eubacteria, archaea, and eukaryotes) and the relationship of genome organization to the form and function of an organism may be clarified.