JYC: CSM17 BioinformaticsCSM17 Week 10: Summary, Conclusions, The Future.....? Bioinformatics is –the study of living systems –with respect to representation,

Slides:



Advertisements
Similar presentations
Chapter 17 Table of Contents Section 1 Biodiversity
Advertisements

Classical and Modern Genetics.  “Genetics”: study of how biological information is carried from one generation to the next –Classical Laws of inheritance.
Chapter 17 Table of Contents Section 1 Biodiversity
Phylogenetic Trees Understand the history and diversity of life. Systematics. –Study of biological diversity in evolutionary context. –Phylogeny is evolutionary.
Plant Molecular Systematics (Phylogenetics). Systematics classifies species based on similarity of traits and possible mechanisms of evolution, a change.
JYC: CSM17 BioinformaticsCSM17 Week 5: DNA and Genetics Genetics Cell Structure DNA Transcription (->RNA) Protein Structure.
BIOINFORMATICS Ency Lee.
Introduction to Genetics A.Definition of “Genetics” B.Proteins C.Nucleic Acids D.The Central Dogma of Genetics E.Historical Perspective.
JYC: CSM17 BioinformaticsCSM17 Week 3: Biological Identification A fundamental activity Traditional methods - keys Special problems Computer-based methods.
UNIT 4 BIOLOGY Continuity and Change: Genetics and Evolution.
. Class 1: Introduction. The Tree of Life Source: Alberts et al.
JYC: CSM17 BioinformaticsCSM17 Week 10: Summary, Conclusions, The Future.....? Bioinformatics is –the study of living systems –with respect to representation,
Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.
JYC: CSM17 BioinformaticsCSM17 Week 6: DNA, RNA and Proteins Transcription (reading the DNA template) Translation (RNA -> protein) Protein Structure.
JYC: CSM17 BioinformaticsCSM17 Week1:What is Bioinformatics? A Multidisciplinary Subject incorporating: Biology –the study of living systems Informatics.
CHAPTER 25 TRACING PHYLOGENY. I. PHYLOGENY AND SYSTEMATICS A.TAXONOMY EMPLOYS A HIERARCHICAL SYSTEM OF CLASSIFICATION  SYSTEMATICS, THE STUDY OF BIOLOGICAL.
JYC: CSM17 BioinformaticsCSM17 Week 3: Biological Identification A fundamental activity Traditional methods - keys Special problems Computer-based methods.
JYC: CSM17 BioinformaticsCSM17 Week 7: Simulations: Genetic Algorithms Evolutionary Computation.
Bioinformatics Original definition (1979 by Paulien Hogeweg): “application of information technology and computer science to the field of molecular biology”
JYC: CSM17 BioinformaticsCSM17 Week 3: Biological Identification A fundamental activity Traditional methods - keys Special problems Computer-based methods.
JYC: CSM17 BioinformaticsCSM17 Week 6: DNA, RNA and Proteins Transcription (reading the DNA template) Translation (RNA -> protein) Protein Structure.
Protein synthesis and replication
Transcription and Translation… Its what make you, YOU!
Biology 12 – the nucleus. Cell structures Is this eukaryotic? yes Why? nucleus Is this a plant or animal cell? animal Why? No cell wall or chloroplasts.
Classification Organizing the Diversity of Life. Why do we classify things? – Supermarket aisles – Libraries – Classes – Teams/sports – Members of a family.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
March 3 rd, 2010  Warm Up Open to ch. 17 to follow along with lecture  Today Review Ch. 17 Lab  Homework Study for Ch. 17 exam on Friday.
Systematics the study of the diversity of organisms and their evolutionary relationships Taxonomy – the science of naming, describing, and classifying.
Prokaryote Taxonomy & Diversity Classification, Nomenclature & Identification Phenetic Classification Molecular Phylogeny Approach Classification (hierarchical.
Classification and Systematics Tracing phylogeny is one of the main goals of systematics, the study of biological diversity in an evolutionary context.
Prokaryote Taxonomy & Diversity
DNA Structure & Function. Perspective They knew where genes were (Morgan) They knew what chromosomes were made of Proteins & nucleic acids They didn’t.
RNA and Protein Synthesis
Protein Synthesis Occurs in 2 steps – Step 1: Transcription Taking DNA and transcribing it into RNA – Step 2: Translation Taking RNA and translating it.
Nucleic Acid Structure Nitrogenous Bases (Nucleosides)
Copyright © by Holt, Rinehart and Winston. All rights reserved. ResourcesChapter menu To View the presentation as a slideshow with effects select “View”
DNA, mRNA, and Protein Synthesis TAKS Review for April 22 test.
Genes and How They Work Chapter The Nature of Genes information flows in one direction: DNA (gene)RNAprotein TranscriptionTranslation.
RNA, Transcription, Translation
Protein Synthesis: Transcription & Translation.
Bioinformatics Dipl. Ing. (FH) Patrick Grossmann
Protein Synthesis The process of protein synthesis is explained by the central dogma of molecular biology, which states that: DNA  RNA  Proteins How.
Classifying the Diversity of Life – Systematics Is the study of the diversity and relationships of organisms, both past and present. – Taxonomy Is the.
Classification Biology I. Lesson Objectives Compare Aristotle’s and Linnaeus’s methods of classifying organisms. Explain how to write a scientific name.
Bioinformatics Overview
Chapter 17 Table of Contents Section 1 Biodiversity
Protein Synthesis.
RNA Ribonucleic Acid Single-stranded
Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,
mRNA DNA tRNA Misc. Protein Synthesis
Protein Synthesis.
DNA, RNA and Protein Synthesis
Transcription and Translation Chapter 12
Chapter 17 Table of Contents Section 1 Biodiversity
Transcription -The main purpose of transcription is to create RNA from DNA because RNA leaves the nucleus to carry out its functions but DNA does not -A.
Genome organization and Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
The Cell Cycle and Protein Synthesis
Chapter 17 Table of Contents Section 1 Biodiversity
DNA, RNA and Protein Synthesis
Patterns of Heredity 4.1 Living things inherit traits in patterns. 4.2
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
DNA Replication vs. Protein Synthesis
Unit 4 - The Natural Environment and Species Survival
AS Level Paper 1 and 2. A2 Level Paper 1 and 3 - Topics 1-4
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Protein Synthesis.
Presentation transcript:

JYC: CSM17 BioinformaticsCSM17 Week 10: Summary, Conclusions, The Future.....? Bioinformatics is –the study of living systems –with respect to representation, organisation, manipulation, distribution, maintenance and use of information

JYC: CSM17 Bioinformatics includes... computer applications in biology IT and IS for management & analysis of biological data –e.g. classification/identification systems, databases, development of analysis tools computational molecular analysis, molecular biology –DNA, RNA, protein amino acid sequences simulations of biological systems artificial intelligence, neural networks

JYC: CSM17 Week 2: Biological Classification fundamental concepts –taxon, species, genus traditional methods –based on ‘expert’ opinion nomenclature (naming) –type concept, type specimens, descriptions taxonomy & systematics cluster analysis / numerical taxonomy

JYC: CSM17 Week 3: Biological Identification a fundamental activity traditional methods - keys special problems –variation, availability of data –information content computer-based methods –DELTA

JYC: CSM17 Week 4: Evolutionary systems evolution and phylogeny historical systems modern methods tools and software –PHYLIP

JYC: CSM17 Week 5: DNA and Genetics genetics, Gregor Mendel and his peas cell structure –mitochondria –chloroplasts DNA (deoxyribonucleic acid) –nucleotide bases –A, C, G, T transcription (reading the DNA template) –producing messenger RNA (mRNA) –A, C, G and U (replaces T in RNA)

JYC: CSM17 Week 6: DNA, RNA and Proteins translation (mRNA -> protein) –tRNA builds up protein –one amino acid at a time protein structure –primary (AA sequence) –secondary (e.g. spiral, helix) –tertiary (complex folding)

JYC: CSM17 Week 7: Molecular Analysis: Sequence alignment –for comparison, identification Multiple sequence alignment –cladistic analysis of molecular sequences

JYC: CSM17 Week 8: Simulations #1: genetic algorithms (GAs) evolutionary computation –simulate sexual reproduction in populations –using ‘chromosomes’ and crossover

JYC: CSM17 Week 9: Simulations #2: plant morphology –leaves, branching, phyllotaxis fractals virtual reality –Lindenmayer systems

JYC: CSM17 Week 10: Conclusions and summary: Is Life an Information System??? Revision

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.