Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Integrative Bioinformatics Institute VU (IBIVU) Tel. 47649,

Slides:



Advertisements
Similar presentations
Martin John Bishop UK HGMP Resource Centre Hinxton Cambridge CB10 1 SB
Advertisements

BIOINFORMATICS Ency Lee.
Bioinformatics What is bioinformatics? Why bioinformatics? The major molecular biology facts Brief history of bioinformatics Typical problems of bioinformatics:
Master Course Sequence Analysis Anton Feenstra, Bart van Houte, Walter Pirovano, Jaap Heringa Tel , Rm.
Bioinformatics at WSU Matt Settles Bioinformatics Core Washington State University Wednesday, April 23, 2008 WSU Linux User Group (LUG)‏
Collaborative Information Management: Advanced Information Processing in Bioinformatics Joost N. Kok LIACS - Leiden Institute of Advanced Computer Science.
Introduction to Bioinformatics Yana Kortsarts Bob Morris.
August 19, 2002Slide 1 Bioinformatics at Virginia Tech David Bevan (BCHM) Lenwood S. Heath (CS) Ruth Grene (PPWS) Layne Watson (CS) Chris North (CS) Naren.
Bioinformatics Master’s Course Genome Analysis ( Integrative Bioinformatics ) Lecture 1: Introduction Centre for Integrative Bioinformatics VU (IBIVU)
. Class 1: Introduction. The Tree of Life Source: Alberts et al.
The Golden Age of Biology DNA -> RNA -> Proteins -> Metabolites Genomics Technologies MECHANISMS OF LIFE Health Care Diagnostics Medicines Animal Products.
Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
Data-intensive Computing: Case Study Area 1: Bioinformatics B. Ramamurthy 6/17/20151.
Course Sequence Analysis for Bioinformatics Master’s Bart van Houte, Radek Szklarczyk, Walter Pirovano, Jaap Heringa
Introduction to Genomics, Bioinformatics & Proteomics Brian Rybarczyk, PhD PMABS Department of Biology University of North Carolina Chapel Hill.
Reconfigurable Computing S. Reda, Brown University Reconfigurable Computing (EN2911X, Fall07) Lecture 18: Application-Driven Hardware Acceleration (4/4)
The Cell, Central Dogma and Human Genome Project.
Master Course Sequence Analysis Anton Feenstra, Bart van Houte, Radek Szklarczyk, Walter Pirovano, Jaap Heringa Tel.
BI420 – Course information Web site: Instructor: Gabor Marth Teaching.
Signaling Pathways and Summary June 30, 2005 Signaling lecture Course summary Tomorrow Next Week Friday, 7/8/05 Morning presentation of writing assignments.
© Wiley Publishing All Rights Reserved. Biological Sequences.
ExPASy - Expert Protein Analysis System The bioinformatics resource portal and other resources An Overview.
Presented by Liu Qi An introduction to Bioinformatics Algorithms Qi Liu
Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.
Meer perspectief Master’s programme in Bioinformatics Bio-tools for the Future International 2-year Bioinformatics Master’s Programme.
Bioinformatics.
How does DNA work? Building the Proteins that your body needs.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
CSE 6406: Bioinformatics Algorithms. Course Outline
Master’s course Bioinformatics Data Analysis and Tools Lecture 1: Introduction Centre for Integrative Bioinformatics FEW/FALW
A brief Introduction to Bioinformatics Y. SINGH NELSON R. MANDELA SCHOOL OF MEDICINE DEPARTMENT OF TELEHEALTH Content licensed under.
Introduction to Bioinformatics Spring 2002 Adapted from Irit Orr Course at WIS.
Molecular Biology Primer. Starting 19 th century… Cellular biology: Cell as a fundamental building block 1850s+: ``DNA’’ was discovered by Friedrich Miescher.
C E N T R F O I G A V B M S U 2MNW/3I/3AI/3PHAR bachelor course Introduction to Bioinformatics Lecture 1: Introduction Centre for Integrative Bioinformatics.
DNA These “genes” never go out of style!! Ms. Kooiman La Serna High School.
Date DNA. ✤ DNA stands for deoxyribonucleic acid ✤ DNA carries all the genetic information of living organisms.
Introduction to Bioinformatics Yana Kortsarts References: An Introduction to Bioinformatics Algorithms bioalgorithms.info.
DNA alphabet DNA is the principal constituent of the genome. It may be regarded as a complex set of instructions for creating an organism. Four different.
National 5 Biology Course Notes Part 4 : DNA and production of
DNA "The Blueprint of Life". DNA stands for... DeoxyriboNucleic Acid.
CSCI 6900/4900 Special Topics in Computer Science Automata and Formal Grammars for Bioinformatics Bioinformatics problems sequence comparison pattern/structure.
Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Centre for Integrative Bioinformatics VU (IBIVU) Tel ,
DIALing the IBIVU Vrije Universiteit Amsterdam Jaap Heringa Centre for Integrative Bioinformatics VU (IBIVU) Faculty of Sciences / Faculty of Earth and.
Course Sequence Analysis for Bioinformatics Master’s Bart van Houte, Radek Szklarczyk, Victor Simossis, Jens Kleinjung, Jaap Heringa
California Content Standards
Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill
WMU CS 6260 Parallel Computations II Spring 2013 Presentation #1 about Semester Project Feb/18/2013 Professor: Dr. de Doncker Name: Sandino Vargas Xuanyu.
Central dogma: the story of life RNA DNA Protein.
EB3233 Bioinformatics Introduction to Bioinformatics.
An overview of Bioinformatics. Cell and Central Dogma.
Bioinformatics and Computational Biology
1 From Mendel to Genomics Historically –Identify or create mutations, follow inheritance –Determine linkage, create maps Now: Genomics –Not just a gene,
Applied Bioinformatics Dr. Jens Allmer Week 1 (Introduction)
Introduction to molecular biology Data Mining Techniques.
CISC667, S07, Lec25, Liao1 CISC 467/667 Intro to Bioinformatics (Spring 2007) Review Session.
Bioinformatics Overview
Data-intensive Computing: Case Study Area 1: Bioinformatics
생물정보학 Bioinformatics.
Protein Synthesis.
Deoxyribonucleic Acid
“Proteomics is a science that focuses on the study of proteins: their roles, their structures, their localization, their interactions, and other factors.”
C E N T R F O I G A V B M S U 2MNW/3I/3AI/3PHAR bachelor course Introduction to Bioinformatics Lecture 1: Introduction Centre for Integrative Bioinformatics.
Genome organization and Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Bioinformatics Vicki & Joe.
Bioinformatics For MNW 2nd Year
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Reconfigurable Computing (EN2911X, Fall07)
Presentation transcript:

Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Integrative Bioinformatics Institute VU (IBIVU) Tel , Rm R4.41

Current Bioinformatics Unit Jens Kleinjung (1/11/02) Victor Simosis – PhD (1/12/02) Radek Szklarczyk - PhD (1/01/03)

Bioinformatics course 2nd year MNW spring 2003 Pattern recognition –Supervised/unsupervised learning –Types of data, data normalisation, lacking data –Search image –Similarity/distance measures –Clustering –Principal component analysis –Discriminant analysis

Bioinformatics course 2nd year MNW spring 2003 Protein –Folding –Structure and function –Protein structure prediction –Secondary structure –Tertiary structure –Function –Post-translational modification –Prot.-Prot. Interaction -- Docking algorithm –Molecular dynamics/Monte Carlo

Bioinformatics course 2nd year MNW spring 2003 Sequence analysis –Pairwise alignment –Dynamic programming (NW, SW, shortcuts) –Multiple alignment –Combining information –Database/homology searching (Fasta, Blast, Statistical issues-E/P values)

Bioinformatics course 2nd year MNW spring 2003 Gene structure and gene finding algorithms Genomics –Expression data, Nucleus to ribosome, translation, etc. –Proteomics, Metabolomics, Physiomics –Databases DNA, EST Protein sequence (SwissProt) Protein structure (PDB) Microarray data Proteomics Mass spectrometry/NMR/X-ray

Bioinformatics course 2nd year MNW spring 2003 Bioinformatics method development Programming and scripting languages Web solutions Computational issues –NP-complete problems –CPU, memory, storage problems –Parallel computing Bioinformatics method usage/application Molecular viewers (RasMol, MolMol, etc.)

Gathering knowledge Anatomy, architecture Dynamics, mechanics Informatics (Cybernetics – Wiener, 1948) (Cybernetics has been defined as the science of control in machines and animals, and hence it applies to technological, animal and environmental systems) Genomics, bioinformatics Rembrandt, 1632 Newton, 1726

Mathematics Statistics Computer Science Informatics Biology Molecular biology Medicine Chemistry Physics Bioinformatics

“Studying informational processes in biological systems” (Hogeweg, early 1970s) No computers necessary Back of envelope OK Applying algorithms with mathematical formalisms in biology (genomics) -- USA “Information technology applied to the management and analysis of biological data” (Attwood and Parry-Smith)

Bioinformatics in the olden days Close to Molecular Biology: –(Statistical) analysis of protein and nucleotide structure –Protein folding problem –Protein-protein and protein-nucleotide interaction Many essential methods were created early on (BG era) –Protein sequence analysis (pairwise and multiple alignment) –Protein structure prediction (secondary, tertiary structure)

Bioinformatics in the olden days (Cont.) Evolution was studied and methods created –Phylogenetic reconstruction (clustering – NJ method

But then the big bang….

The Human Genome June 2000

Dr. Craig Venter Celera Genomics -- Shotgun method Sir John Sulston Human Genome Project

Human DNA There are about 3bn (3  10 9 ) nucleotides in the nucleus of almost all of the trillions (3.5  ) of cells of a human body (an exception is, for example, red blood cells which have no nucleus and therefore no DNA) – a total of ~10 22 nucleotides! Many DNA regions code for proteins, and are called genes (1 gene codes for 1 protein in principle) Human DNA contains ~30,000 expressed genes Deoxyribonucleic acid (DNA) comprises 4 different types of nucleotides: adenine (A), thiamine (T), cytosine (C) and guanine (G). These nucleotides are sometimes also called bases

Human DNA (Cont.) All people are different, but the DNA of different people only varies for 0.2% or less. So, only 2 letters in 1000 are expected to be different. Over the whole genome, this means that about 3 million letters would differ between individuals. The structure of DNA is the so-called double helix, discovered by Watson and Crick in 1953, where the two helices are cross-linked by A-T and C-G base-pairs (nucleotide pairs – so-called Watson-Crick base pairing).

Modern bioinformatics is closely associated with genomics The aim is to solve the genomics information problem Ultimately, this should lead to biological understanding how all the parts fit (DNA, RNA, proteins, metabolites) and how they interact (gene regulation, gene expression, protein interaction, metabolic pathways, protein signalling, etc.) More in the next lecture…