UCSC BIOINFORMATICS Richard Hughey Vice-Chair, Biomolecular Engineering.

Slides:

Advertisements

Similar presentations

Department of Statistics R.W. Doerge West Lafayette, IN Developing statistics programs for majors outside of statistics and.

Advertisements

1 Multidisciplinary Program in Computational Biology and Bioinformatics Biology / Agriculture Track CS Track Physics / Mathematics Track Initiated 2000.

Orientation Information Session Dr Shaun Roman B.Biotechnology.

A Lite Introduction to (Bioinformatics and) Comparative Genomics Chris Mueller August 10, 2004.

Spring CSE Master’s Programs Spring 2008 Mike O’Dell CSE Graduate Advisor.

EDUCATION Example programs: Stanford, Illinois, Rice 1.Organizational structures of MS/Ph.D. programs in CSE – pros and cons 2.Curricular content of graduate.

 Preparing undergraduates to succeed in college and beyond in a bioinformatics-rich curriculum  Discussion of existing resources, opportunities, and.

Educational Programs in Bioinformatics at UNO Hesham H. Ali Department of Computer Science College of Info Science and Technology University of Nebraska.

1 CMPE1 Hands-on Computer Engineering Tracy Larrabee with help from Richard Hughey, et al. Tutors: Stephanie, Tina.

Bioinformatics: One Minute and One Hour at a Time Laurie J. Heyer L.R. King Asst. Professor of Mathematics Davidson College

Newark Division of GSBS Degrees Offered: Ph.D. Ph.D. M.D. / Ph.D. M.D. / Ph.D. D.M.D / Ph.D. D.M.D / Ph.D. M.S. M.S. M.S./MBA M.S./MBA.

Southern California Bioinformatics Summer Institute Wendie Johnston, Beverly Krilowicz, Jamil Momand, Sandra Sharp, Nancy Warter- Perez.

The Golden Age of Biology DNA -> RNA -> Proteins -> Metabolites Genomics Technologies MECHANISMS OF LIFE Health Care Diagnostics Medicines Animal Products.

Engineering Programs at GMU (Lecture #4) ENGR 107 – Intro to Engineering The slides included herein were taken from the materials accompanying Engineering.

Southern California Bioinformatics Summer Institute Wendie Johnston, Beverly Krilowicz, Jamil Momand, Sandra Sharp, Nancy Warter-Perez.

Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.

1 CMPE1 Hands-on Computer Engineering Tracy Larrabee with help from Richard Hughey, et al. Tutors: Stephanie, Tina.

Southern California Bioinformatics Summer Institute Wendie Johnston, Beverly Krilowicz, Jamil Momand, Sandra Sharp, Nancy Warter-Perez.

Richard Hughey Chair, B.S. in Bioengineering Professor, Computer & Biomolecular Engineering B.S. in Bioengineering Jack Baskin School of Engineering.

Comparative Genomics Bio Informatics Scott Gulledge.

Introduction to Bioinformatics (Lecture for CS498-CXZ Algorithms in Bioinformatics) Aug. 25, 2005 ChengXiang Zhai Department of Computer Science University.

Graduate Opportunities in Bioinformatics By Tristan Butterfield Alternative Career Presentation Senior Seminar,

Different views of bioinformatics CS view: what are the algorithms, data structures and other concepts needed to develop tools to solve biological problems.

1 CMPE1 Hands-on Computer Engineering Richard Hughey Guest Faculty Tutors: Stephanie, Tina.

Introduction to Bio-Engineering HSSP 2402 Leigh Casadaban and Alina Gatowski HSSP 2402 Leigh Casadaban and Alina Gatowski.

 The field of statistics provides the scientist with some of the most useful techniques for evaluating ideas, testing theory, and discovering the.

Algorithms in Computational Biology Tanya Berger-Wolf Compbio.cs.uic.edu/~tanya/teaching/CompBio January 13, 2006.

Marine Biotechnology and Bioinformatics Teacher Enhancement Program at Moss Landing Marine Labs Careers in Biology Emphasis on Biotechnology and Bioinformatics.

Bioinformatics Curriculum Guidelines: Toward a Definition of Core Competencies Lonnie Welch School of Electrical Engineering & Computer Science Biomedical.

David L. Spooner1 IT Education: An Interdisciplinary Approach David L. Spooner Rensselaer Polytechnic Institute.

8/15/2015Bioinformatics and Computational Biology Undergraduate Major 1 Iowa State University College of Liberal Arts and Sciences Bioinformatics & Computational.

FAMU-FSU College of Engineering. Introduction to Engineering  What is engineering? “Application of science and math to solve problems”  Why do we need.

1 CMPE1 Hands-on Computer Engineering Stephen Petersen Richard Hughey.

Computing For Biology An online course for A-level students Runs 18 th to 29 th August 2014 TCGATTCCAGAACTAGGCATTATAGATAGATTCAG ATAGGACATAGATCGATTCAGATAGGATATAATCG.

ENGINEERING ORIENTATION Information on Bioengineering Curriculum and Area Electives Dr. A. Saterbak Dr. K.-Y. San.

Bioinformatics Sean Langford, Larry Hale. What is it?  Bioinformatics is a scientific field involving many disciplines that focuses on the development.

What is Biotechnology?.

Computer Science Graduate Studies in U of Memphis.

Introduction to Bioinformatics Prologue. Bioinformatics Living things have the ability to store, utilize, and pass on information Bioinformatics strives.

The Mathematics Department of the University of Southern California Francis Bonahon, Professor and Acting Chair Asher Shamam, Graduate Student.

Bioinformatics minor at UNI. What is Bioinformatics? Developing software tools for mining biological databases. Utilizing software tools to perform biological.

Master’s Degrees in Bioinformatics in Switzerland: Past, present and near future Patricia M. Palagi Swiss Institute of Bioinformatics.

Workshop on Education in Bioinformatics and Computational Biology WEBCB Sep 2009 Discussion Session Bruno Gaeta, Shoba Ranganathan Tan Tin Wee,

A Lite Introduction to (Bioinformatics and) Comparative Genomics Chris Mueller November 18, 2004 Based on the Genomics in Biomedical Research course at.

Bioinformatics Education at North Central College Caroline St.Clair Professor of Computer Science.

Aliya Sadeque BIOC 599 Supervisory Committee Meeting Wednesday December 19, 2007.

What is Research? My University & Personal Perspective Nancy Amato, Texas A&M University

Introduction to Bioinformatics (Lecture for CS397-CXZ Algorithms in Bioinformatics) Jan. 21, 2004 ChengXiang Zhai Department of Computer Science University.

Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill

Information Technology in the Natural Sciences Biology – Chemistry – Physics.

Bioinformatics Curriculum Issues, goals, curriculum.

COMPUTATIONAL BIOLOGIST DR. MARTIN TOMPA Place of Employment: University of Washington Type of Work: Develops computer programs and algorithms to identify.

UIC College of Engineering Six Academic Departments with Graduate and Undergraduate Programs Bioengineering, Chemical Engineering, Civil & Materials Engineering,

Bioinformatics Chem 434 Dr. Nancy Warter-Perez Computer Engineering Dr. Jamil Momand Chemistry & Biochemistry.

+ Melanie Donahue Biomedical Researcher. + Education Graduated from Sturgis in 2007 Researched and applied to undergraduate institutions with strong math.

Interdisciplinary Research Interests.

Industry Advisory Board May 29 th, 2015

Graduate Research with Bioinformatics Research Mentors Nancy Warter-Perez, ECE Robert Vellanoweth Chem and Biochem Fellow Sean Caonguyen 8/20/08.

Industry Advisory Board

Using core competencies in curriculum design

Accelerated B.S./M.S An approved Accelerated BS/MS program allows an undergraduate student to take up to 6 graduate level credits as an undergraduate.

BEng(CompSc) Curriculum Structure & Highlights

LEARN WHY COMPUTERS ARE REVOLUTIONIZING BIOLOGY!

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

LESSON 1 INTNRODUCTION HYE-JOO KWON, Ph.D /

WELCOME TO ALL.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

UCSC BIOINFORMATICS Richard Hughey Vice-Chair, Biomolecular Engineering

Bioinformatics The application of computer and statistical techniques to biological data Bioinformatics spans mathematics, engineering, and science –Designing tools for the understanding of biomolecules and biological processes –Designing tool chains to solve problems –Working with biologists to design better experiments

Bioinformatics Tool Using Analyze multiple genomes to track down a genetic disease Determine the structure of a protein to enable drug development Design ways to use proteins and signal processing to make DNA sequencing cheaper

Bioinformatics Tool Building Apply statistics, programming, and biochemistry to predict protein structure Create a genome browser to answer 125,000 questions a day Developing a signal processing algorithm to read DNA

Bioinformatics BS Founded on our internationally- recognized research program First Bioinformatics BS in California (2001) Students continue to graduate school or join the biotech industry

Bioinformatics BS A difficult engineering program with: Math (6 classes) including Bayesian statistics (graduate course!) Science (7 classes) Engineering (6 classes) Bioinformatics (4 classes): Bioethics Computational biology tools Introduction to bioinformatics (graduate course!) Protein bioinformatics (graduate course!) Electives (2 classes)

Why Stop? You’ve already taken three graduate courses So join our BS/Graduate Program –You can double-count the three gradate courses and bioethics –MS requires just 5 more courses and 4 seminars MS thesis may begin with an undergraduate research project

How do I get started Come talk to us immediately!! Join us for bread & tea on Fridays Come to a quarterly student-faculty lunch (BINFFL)

What else can I do? Undergraduate Research –Many summer and academic year opportunities Bioinformatics Minor –Fits well with MCD Biology, Computer Science, or Computer Engineering Double Major –Several graduates have double-majored or majored/minored between MCD Biology and Bioinformatics Bioengineering Degrees under development