Xuhua Xia xxia@uottawa.ca http://dambe.bio.uottawa.ca Mutation Xuhua Xia xxia@uottawa.ca http://dambe.bio.uottawa.ca

Mutation - any detectable change in DNA sequence eg. errors in DNA replication/repair inherited ones of interest in evolutionary studies Deleterious - will be selected against and lost (purifying selection) Advantageous will be fixed in population by natural selection - rare occurrence Neutral will have not effect on phenotype - may be fixed in population by genetic drift Xuhua Xia

Type of Mutations 1. Point mutations Transition = purine to purine or pyrimidine to pyrimidine Transversion = purine to pyrimidine How many possible transitions? transversions? p.38 “In animal nuclear DNA, ~ 60-70% of all point mutations are TRANSITIONS, whereas if random expect 33%” Xuhua Xia

Types of mutations Missense mutation - different aa specified by codon Nonsense mutation - change from sense codon to stop codon Non-synonymous - amino acid altered Synonymous - “silent” change 2. Insertions or deletions (“indels”) - frameshift mutations within coding sequences Fig. 1.12 Xuhua Xia

Spontaneous Point Mutation Rates G – genome size µb – mutation rate per site per generation µg – genomic mutation rate per generation Table 4 in Drake et al. 1998, Genetics Xuhua Xia

Slippage and Short Indels Short insertions or deletions (short “indels”) eg. if slippage during DNA replication rapid evolution change in copy number of short tandem repeats microsatellites Fig.1.18 Xuhua Xia

Normal and Thalassemia HBb 10 20 30 40 50 60 ----|----|----|----|----|----|----|----|----|----|----|----|-- Normal AUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCGUUACUGCCCUGUGGGGCAAGGUGAACGU Thalass. AUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCGUUACUGCCCUGUGGGGCAAGGUGAACGU ************************************************************** 70 80 90 100 110 120 --|----|----|----|----|----|----|----|----|----|----|----|---- Normal GGAUGAAGUUGGUGGU-GAGGCCCUGGGCAGGUUGGUAUCAAGGUUACAAGACAGG...... Thalass. GGAUGAAGUUGGUGGUUGAGGCCCUGGGCAGGUUGGUAUCAAGGUUACAAGACAGG...... **************** *************************************** Are the two genes homologous? What evolutionary change can you infer from the alignment? What is the consequence of the evolutionary change? Xuhua Xia

Synonymous mutation = silent mutation? Do you agree or disagree with the following statement? see p.27 “A synonymous mutation may not always be silent.” Fig. 6.23 Xuhua Xia

Triplet repeat disorder - increased copy number of tandem repeats of triplets within gene (or regulatory region) - certain human genetic (neurodegenerative) diseases - repeat number strongly correlates with age of onset of disease and severity DM1: Dystrophia myotonica-protein kinase, DMPK on Chr 19 DM2: ZNF9 gene on chromosome 3q21. HTT on chr 4q16.3 Repeat copy number in normal = red; orange = carrier; yellow = disease condition Gerald Karp 2007. Cell and Molecular Biology: Concepts and Experiments p.435 Xuhua Xia Category I: Huntington’s disease (HD) and the spinocerebellar ataxias, CAG in CDS. Category II: expansions tend to be more phenotypically diverse with heterogeneous expansions that are generally small in magnitude, but also found in the exons of genes. Category III: fragile X syndrome, myotonic dystrophy, juvenile myoclonic epilepsy, and Friedreich’s ataxia, non-CDS.

Fragile X Syndrome male II-1 asymptomatic hemizygous carrier wt mutant male II-1 asymptomatic hemizygous carrier daughter III-1 asymptomatic, but expanded repeat in germ line Bassell GJ, Warren ST (2008). "Fragile X syndrome: loss of local mRNA regulation alters synaptic development and function". Neuron 60 (2): 201–14. FMRP from FMR1 Xuhua Xia

Huntington’s disease 4p16.3 Xuhua Xia

Inversions, translocations, etc. through chromosome breakage & rejoining Fig. 1.20 - shown as single stranded, but both DNA strands inverted Xuhua Xia

Inversions, translocations, etc. - recombination between indirect repeats What would be outcome of recombination between direct repeats? Fig. 1.20 Xuhua Xia

Deletion A B C D A D … … … … + See Fig. 1.17 Xuhua Xia

“Hot spots” of mutation - short direct repeats, palindromes - alternating Pu-Py dimers (Z-DNA) - CpG in eukaryotes -deamination of C to U, repaired by uracil-DNA glycolyase - but 5-methyl C to T escapes repair patterns & positions of mutations not random Griffiths Fig. 7.16 Xuhua Xia