Potato Genomics and Bioinformatics

Slides:



Advertisements
Similar presentations
C3.ca in Atlantic Canada Virendra Bhavsar Director, Advanced Computational Research Laboratory (ACRL) Faculty of Computer Science University of New Brunswick.
Advertisements

Prof. Carolina Ruiz Computer Science Department Bioinformatics and Computational Biology Program WPI WELCOME TO BCB4003/CS4803 BCB503/CS583 BIOLOGICAL.
Global Alignment and Collaboration Jo
JYC: CSM17 BioinformaticsCSM17 Week 10: Summary, Conclusions, The Future.....? Bioinformatics is –the study of living systems –with respect to representation,
Bioinformatics at WSU Matt Settles Bioinformatics Core Washington State University Wednesday, April 23, 2008 WSU Linux User Group (LUG)‏
Advanced Computational Research Laboratory (ACRL) Virendra C. Bhavsar Faculty of Computer Science University of New Brunswick Fredericton, NB, E3B 5A3.
August 19, 2002Slide 1 Bioinformatics at Virginia Tech David Bevan (BCHM) Lenwood S. Heath (CS) Ruth Grene (PPWS) Layne Watson (CS) Chris North (CS) Naren.
Structural Genomics – an example of transdisciplinary research at Stanford Goal of structural and functional genomics is to determine and analyze all possible.
The Golden Age of Biology DNA -> RNA -> Proteins -> Metabolites Genomics Technologies MECHANISMS OF LIFE Health Care Diagnostics Medicines Animal Products.
JYC: CSM17 BioinformaticsCSM17 Week 10: Summary, Conclusions, The Future.....? Bioinformatics is –the study of living systems –with respect to representation,
Computational Molecular Biology (Spring’03) Chitta Baral Professor of Computer Science & Engg.
JYC: CSM17 BioinformaticsCSM17 Week1:What is Bioinformatics? A Multidisciplinary Subject incorporating: Biology –the study of living systems Informatics.
NICLS: Development of Biomedical Computing and Information Technology Infrastructure Presented by Simon Sherman August 15, 2005.
Scientific Data Mining: Emerging Developments and Challenges F. Seillier-Moiseiwitsch Bioinformatics Research Center Department of Mathematics and Statistics.
Transforming Research in Atlantic Canada ACEnet. Objectives Describe ACEnet Describe our relationship with the ORAN and with CA*Net 4 Briefly describe.
Introduction to Bioinformatics (Lecture for CS498-CXZ Algorithms in Bioinformatics) Aug. 25, 2005 ChengXiang Zhai Department of Computer Science University.
Who am I and what am I doing here? Allan Tucker A brief introduction to my research
Intelligent Systems Group Emmanuel Fernandez Larry Mazlack Ali Minai (coordinator) Carla Purdy William Wee.
We are developing a web database for plant comparative genomics, named Phytome, that, when complete, will integrate organismal phylogenies, genetic maps.
Algorithms in Computational Biology Tanya Berger-Wolf Compbio.cs.uic.edu/~tanya/teaching/CompBio January 13, 2006.
Data Mining – Intro.
341: Introduction to Bioinformatics Dr. Natasa Przulj Deaprtment of Computing Imperial College London
Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.
Parallel and Distributed Intelligent Systems Virendrakumar C. Bhavsar Professor and Director, Advanced Computational Research Laboratory Faculty of Computer.
Data Warehouse Fundamentals Rabie A. Ramadan, PhD 2.
Issues in Teaching Software Engineering Virendra C. Bhavsar Professor and Director, Advanced Computational Research Laboratory Faculty of Computer Science.
Potato Genomics In Fredericton Dr. Barry Flinn Co-Lead Investigator - Genome Atlantic CPGP Research Director - Solanum Genomics International Inc.
Information Systems in MBS UG Studies Dr. Ilias Petrounias Room 3.19, MBS West
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
A Vision of Computer Science at UNB Virendrakumar C. Bhavsar Professor and Director, Advanced Computational Research Laboratory Faculty of Computer Science,
Parallel and Distributed Intelligent Systems: Multi-Agent Systems and e- Commerce Virendrakumar C. Bhavsar Professor and Director, Advanced Computational.
© Integromics, All Rights Reserved | EXECUTIVE PRESENTATION Global Solutions for Life Sciences.
Definition of Computational Science Computational Science for NRM D. Wang Computational science is a rapidly growing multidisciplinary field that uses.
A New Oklahoma Bioinformatics Company. Microarray and Bioinformatics.
Canadian Potato Genome Project (CPGP) (Molecular Determination of Tuber Health and Quality in the Potato) Barry Flinn SGII/BioAtlantech (Fredericton) Sharon.
Future of High Performance Computing at UNB Virendra Bhavsar & Chris MacPhee Advanced Computational Research Laboratory (ACRL) Faculty of Computer Science.
My Research and e-Business Virendrakumar C. Bhavsar Professor and Director, Advanced Computational Research Laboratory Faculty of Computer Science University.
AC3 Atlantic Canada Computing Consortium Mark Whitmore Memorial University of Newfoundland.
UNB ACRL: Current Infrastructure, Programs, and Plans Virendra Bhavsar Professor and Director, Advanced Computational Research Laboratory (ACRL) Faculty.
Multi-Agent Systems for e-Commerce Virendra C. Bhavsar Professor and Director, Advanced Computational Research Laboratory Faculty of Computer Science,
REMINDERS 2 nd Exam on Nov.17 Coverage: Central Dogma of DNA Replication Transcription Translation Cell structure and function Recombinant DNA technology.
1 Le Thi Thu Thuy*, Doan Dai Duong*, Virendrakumar C. Bhavsar* and Harold Boley** * Faculty of Computer Science, University of New Brunswick, Fredericton,
Major Disciplines in Computer Science Ken Nguyen Department of Information Technology Clayton State University.
Bioinformatics and Biostatistics in Limagrain / Biogemma
Introduction to Bioinformatics (Lecture for CS397-CXZ Algorithms in Bioinformatics) Jan. 21, 2004 ChengXiang Zhai Department of Computer Science University.
Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.
Mining Biological Data. Protein Enzymatic ProteinsTransport ProteinsRegulatory Proteins Storage ProteinsHormonal ProteinsReceptor Proteins.
AdvancedBioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2002 Mark Craven Dept. of Biostatistics & Medical Informatics.
Structural Models Lecture 11. Structural Models: Introduction Structural models display relationships among entities and have a variety of uses, such.
August 3, March, The AC3 GRID An investment in the future of Atlantic Canadian R&D Infrastructure Dr. Virendra C. Bhavsar UNB, Fredericton.
Bioinformatics Group at UNB: Strengths in Computer Science Virendra C. Bhavsar Faculty of Computer Science University of New Brunswick Fredericton, NB,
XML-Based Grid Data System for Bioinformatics Development Noppadon Khiripet, Ph.D Wasinee Rungsarityotin, MS Chularat Tanprasert, Ph.D Royol Chitradon.
1 Bioinformatics at Norwegian University of Science and Technology Professor Finn Drabløs Department of Cancer Research and Molecular Medicine Finn Drabløs.
GeWorkbench Overview Support Team Molecular Analysis Tools Knowledge Center Columbia University and The Broad Institute of MIT and Harvard.
Bioinformatics Dipl. Ing. (FH) Patrick Grossmann
Data Mining Concepts and Techniques Course Presentation by Ali A. Ali Department of Information Technology Institute of Graduate Studies and Research Alexandria.
Chapter 9 : Application Areas. 2 Some Advance Application Areas of Computers  Software Development  Artificial Intelligence  Robotics  Industrial.
1 Survey of Biodata Analysis from a Data Mining Perspective Peter Bajcsy Jiawei Han Lei Liu Jiong Yang.
Graduate Research with Bioinformatics Research Mentors Nancy Warter-Perez, ECE Robert Vellanoweth Chem and Biochem Fellow Sean Caonguyen 8/20/08.
MarketsandMarkets Presents Bioinformatics Market worth $7.5 Billion By 2017
BME435 BIOINFORMATICS.
Bioinformatics Overview
Presented by Terry Peckham
CS 1010– Introduction to Computer Science
First work in AI 1943 The name “Artificial Intelligence” coined 1956
Prediction of Regulatory Elements for Non-Model Organisms Rachita Sharma, Patricia.
What is Pattern Recognition?
Data Warehousing and Data Mining
Comparisons of Clustering Detection and Neural Network in E-Miner, Clementine and I-Miner Jong-Hee Lee and Yong-Seok Choi.
Visualization of Content Information in Networks using GlyphNet
Presentation transcript:

Potato Genomics and Bioinformatics Virendra C. Bhavsar Advanced Computational Research Laboratory Faculty of Computer Science University of New Brunswick Fredericton, NB, Canada bhavsar@unb.ca

Outline Introduction Potato Research in Atlantic Canada Bioinformatics Conclusion

Potato Genomics in Atlantic Canada Superlative research infrastructure Superior industrial infrastructure World-class expertise in potato variety development An industry completely connected to global markets Canadian repository of potato germ plasm

Potato Researchers in Canada

Superior Industrial Infrastructure NB = Int’l headquarters for the world’s largest producer of frozen french fries Processing plants in 11 countries $5.5 billion in sales, employing 12,000 world-wide NB = int’l headquarters for variety testing Int’l conduit for varieties developed here

Superior Industrial Infrastructure Atlantic Region is home to : several other processors: incl. Cavendish, Smallfry/ Humpty-Dumpty, CANUSA. Canadian arm of the world’s largest seed potato company Atlantic region (incl. Maine) is 2nd largest potato growing region in North America

BioAtlantech UNB, NSAC, Carleton, Laval, Mtl., Moncton Atlantic Provincial Governments International Potato Centers Potato growers & processors Agriculture & Agri-food Canada - Fredericton, Charlottetown, Lethbridge Genomics companies Seed companies

Embryogenesis Potato Genome Database seeds vs. tubers: 2 tons of tubers versus 100 g seed Tuber quality traits: sugar content dry matter content after-cooking darkening sprouting/dormancy etc. Potato Genome Database Resistance to : Late blight scab viruses CPB etc. Molecular farming: plants as bio-factories for structural polymers pharmaceuticals; vaccines etc. Nutrient uptake efficiency and stress resistance

Identifying important genes in Potato Identification Gene Expression Gene Function

Bioinformatics Coordinated by Dr. Virendra Bhavsar, UNB Potato Genome Database Identify better ways to organize and mine genomic data Improve existing bioinformatic tools to meet the needs of potato researchers

Bioinformatics Group Eric Aubanel Virendra Bhavsar David Bremner Weichang Du Patricia Evans Ali Ghorbani Lev Goldfarb Claudia Iturriaga Steve Marsh (NRC) Bradford Nickerson Rachael Ritchie (RPC) Todd Wareham (MUN)

BioMATS: Bioinformatics: Models, Algorithms, Tools and Systems Computational Models Computational Algorithms Tools and Systems, including databases

Models Statistical Models Artificial Neural Networks (ANNs) Evolving Transformation Systems Evolutionary Computing Prototeins - Models of Protein Folding Database Models

Computational Algorithms Microarray Analysis Multi-dimensional Spatial Data Representation and Search Structural Pattern Search Parallel and Distributed Algorithms

Microarray Analysis Structure Analysis Expression Analysis, including clustering Integration of Structure and Expression Interaction of Gene Products (e.g. DNA, proteins, and RNA)

Tools Gene Expression Analysis Tool Multi-Agent System for Automatic Annotation based on ACORN Data Mining Tools (e.g. IBM Intelligent Data Miner) Homology Modeling Tools Interactive Visualization Tools Web-based Data Access and Mgmt. Tools

Databases Potato Genome Database Annotation of Databases Interrelating Information from Databases Scalable Databases and Servers

Advanced Computational Research Laboratory High Performance Computational Problem-Solving and Visualization Environment Computational Experiments in multiple disciplines: CS, Science and Eng. 16-Processor IBM SP with 24 GFLOPS performance, 181.2 GB Storage Member of C3.ca Association, Inc. (http://www.c3.ca)

Conclusion Potato Genomics Proposal BioMATS Proposal Potential Collaborations