Sexually dimorphic gene expression in somatic tissues. Authors: J. Isensee and P.Ruiz Noppinger Center for Cardiovascular Research, Center for Gender in.

Slides:



Advertisements
Similar presentations
Genetic Analysis of Genome-wide Variation in Human Gene Expression Morley M. et al. Nature 2004,430: Yen-Yi Ho.
Advertisements

Gender.
Mapping Genetic Risk of Suicide Virginia Willour, Ph.D.
Gene regulatory network
4.A.3 Cell Specialization Interactions between external stimuli and regulated gene expression result in specialization of cells, tissues and organs.
Genetics of Sex Sex Determination Evolution of Sex Chromosomes
Microarrays and Cancer Segal et al. CS 466 Saurabh Sinha.
Hormones in Animals Endocrinology D R Davies School of Biological Sciences Purves Life: the Science of Biology Chapters 41 (Animal Hormones) and 15 (Cell.
Regulation of Metabolism How does the body know when to increase metabolism? Slow metabolism? What might be some indicators of energy status within the.
Chapter 17 Sex and the Brain
More regulating gene expression. Fig 16.1 Gene Expression is controlled at all of these steps: DNA packaging Transcription RNA processing and transport.
Paola CASTAGNOLI Maria FOTI Microarrays. Applicazioni nella genomica funzionale e nel genotyping DIPARTIMENTO DI BIOTECNOLOGIE E BIOSCIENZE.
The Hunt for Chromosomal Determinants of Maleness— A gene mapping story……. The Hunt for Chromosomal Determinants of Maleness— A gene mapping story…….
SRY Gene on Chromosome Y Jon Scales Genetics Fall GTAACAAAGAATCTGGTAGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCA 61 CCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATG.
Anterior pituitary hormones
Animal Reproduction Organization Homeostasis. Review of Meiosis Let’s review meiosis with our human homologous chromosomes activity!
Amandine Bemmo 1,2, David Benovoy 2, Jacek Majewski 2 1 Universite de Montreal, 2 McGill university and Genome Quebec innovation centre Analyses of Affymetrix.
Chapter 45 Hormones and the Endocrine System. The Body’s Long-Distance Regulators The Body’s Long-Distance Regulators An animal hormone An animal hormone.
Growth Hormone Jessica crownover. GROWTH HORMONE IS… is a peptide hormone that stimulates growth, cell reproduction and regeneration in humans and other.
Endocrine System Hormones Why are hormones needed? – chemical messages from one body part to another – communication needed to coordinate whole.
Option H: H.1 – Hormonal Control. Hormones Chemical messenger secreted directly into the bloodstream –Secreted by endocrine cells or neurosecretory cells.
Figure 30.1 Sexually dimorphic anatomy in the hawk moth, Manduca sexta
Illinois State University Hormonal Regulation of Exercise Chapter 21 and 22.
More regulating gene expression. Combinations of 3 nucleotides code for each 1 amino acid in a protein. We looked at the mechanisms of gene expression,
Griffiths, M., Marks, H. P., & Young, F. G. (1941). Influence of (Œstrogens and Androgens on Glycogen Storage in the Fasting Rat. Nature, 147 (3725), 359–359.
William A. Craig Symposium ISAP Research Meeting PK/PD and Genomics David Andes University of Wisconsin.
Regulation of Gene Expression. You Must Know The functions of the three parts of an operon. The role of repressor genes in operons. The impact of DNA.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece.
Hormones & Sexual Development Lecture 25. Sex, & Gender n Sex l biological differences l male & female l intersex n Gender l self-identity about sex role.
Topics for this lecture:
Thoughts on Sex, Gender and Evolution. Marianne J. Legato, M.D.* *With A Lot of Help from Charles Darwin et al.
Chemical Structures of the Three Main Hormone Types.
Mosby items and derived items © 2007, 2005, 2002 by Mosby, Inc., an affiliate of Elsevier Inc. CHAPTER 50 Gene Therapy and Pharmacogenomics.
Chapter 11: cell signals Without cell signaling, no multicellular organisms could exist. Cells would use their genomes equivalently. Cell signals allow.
DECIPHERING THE EARLY BOVINE HOST RESPONSE AFTER Brucella melitensis INFECTION ROSSETTI CA 1 * DRAKE K 2, LAWHON S 3, NUNES J 3, GULL T 3, KHARE S 3, EVERTS.
Pathways between Genes and Behaviour. Functional Genomics Understanding the pathways between genes and behaviours (i.e., mechanisms of genes affecting.
Copyright © 2004 Pearson Education, Inc., publishing as Benjamin Cummings Dee Unglaub Silverthorn, Ph.D. H UMAN P HYSIOLOGY PowerPoint ® Lecture Slide.
The type of target influence the type of drug Main drugs’ categories –Small molecules –Biologicals (e.g. antibodies, hormones, etc) The drug discovery.
Homework #2 is due 10/17 Bonus #1 is due 10/24 Exam key is online Office hours: M 10/ :30am 2-5pm in Bio 6.
Combinatorial control of cell fates Signal 1Signal 2Selector ASelector B Target Gene XTarget Gene Y Target Gene Z Cell fate  Cell fate  Cell fate A relatively.
AP Biology Endocrine System Hormones AP Biology Regulation  Why are hormones needed?  chemical messages from one body part to another  communication.
Dr. Andersen
Genes Activity  Aims:  Must be able to outline the various functions of genes.  Should be able to outline how genes can be activated and when and where.
Nature as blueprint to design antibody factories Life Science Technologies Project course 2016 Aalto CHEM.
Date of download: 6/2/2016 Copyright © The American College of Cardiology. All rights reserved. From: Omega-3 Fatty Acids and Cardiovascular Disease: Effects.
The hypothalamo-pituitary-adrenal axis (HPAA) and the female hypothalamo-pituitary-gonadal axis (HPGA).
Chapter 40 The endocrine system.
HORMONES & THE ENDOCRINE SYSTEM Ashley Gutierrez, Divya Khullar Ms. Said AP Biology, per.6,7.
BCS/NSC 249 Developmental Neurobiology Mary Wines-Samuelson Textbook:
Generously shared by
Animal Structure and Function Organization of cells into systems that are specialized for particular functions. –Tissues- 4 general categories 1.Epithelial.
Estrogen & Estrogen Receptor
Chemical Control in Mammals
Animal Science 434 Reproductive Physiology
Different Types of Chemical Signals Can Be Received by Cells
Dept of Biomedical Informatics University of Pittsburgh
6.6 – Hormones, homeostasis and reproduction
Are Complex Behaviors Specified by Dedicated Regulatory Genes
“Proteomics is a science that focuses on the study of proteins: their roles, their structures, their localization, their interactions, and other factors.”
more regulating gene expression
The Human Endocrine System
The Endocrine System 16.
Hormones and the Endocrine System
The mRNA stem cell signature.
Genetic Differentiation 1. H-Y Antigen- Histocompatability Y antigen 1. Male specific antigen present on the surfaces of cells XY = H-Y antigen.
The Endocrine System Miss Richardson SBI4U.
6.6 Hormones, homeostasis and reproduction
In these studies, expression levels are viewed as quantitative traits, and gene expression phenotypes are mapped to particular genomic loci by combining.
Genetic variation in DREs could be a causative factor in dysregulation of distal target gene expression. Genetic variation in DREs could be a causative.
Hormones Biology 12.
Presentation transcript:

Sexually dimorphic gene expression in somatic tissues. Authors: J. Isensee and P.Ruiz Noppinger Center for Cardiovascular Research, Center for Gender in Medicine Max-Planck Institute for Molecular Genetics, Berlin, Germany Not gene after gene but genes simultaneous: DNA microarrays

1. DIFFERENCES DUE TO THE ANALYTICAL PLATFORM: The most prominent overlap of 87 genes was found between the studies of Yang et al. and Clodfelter et al. both conducted using the Agilent platform. This finding clearly indicates that the platform has a major impact on the detectable sexual dimorphisms. Significantly fewer genes were detected by the Affymetrix platform with only one gene (Uty) being exclusively detected by this platform. 2. Gene results are translated to processes like “steroid synthesis” or “fatty acid metabolism” by gene ontology annotation (David) Could the results also be analysed by pathway-analysis programs like GeneMapp to find molecular pathways?

3. Since most of the sexually dimorphic genes displayed <1.2-fold changes between males and females 81.3% for liver, 71.4% for adipose tissue, 82.5% for muscle, 94.4% for brain sex differences seem wide spread, but of minor extent. Should be given more attention if changes are significant!

4. Abstract. This review focuses on basic regulatory mechanisms of sex-specific gene expression and discusses recent gene expression profiling studies to outline basic differences between sexes on transcriptome level in somatic tissues. In rodents as well as in humans GH is released from alpha cells in the anterior pituitary in males in a cyclical manner with high amplitudes. In females, smaller amplitudes and higher pulse frequencies are leading to a more constant plasma level. Genomic and nongenomic actions of sex steroid hormones might converge on the regulation of target genes via signal transduction pathways modulating the activity of several transcription factors. Hormone binding also induces the recruitment of a broad array of Co-regulatory proteins. Cell-specific expression of co-regulatory proteins and their modulation by posttranslational modifications allow tissue-specific and temporal steroid hormone receptor-mediated transcription.

5. In rodents as well as in humans GH is released from alpha cells in the anterior pituitary in males in a cyclical manner with high amplitudes. In females, smaller amplitudes and higher pulse frequencies are leading to a more constant plasma level. Consequences but not causes are mentioned 6. Despite the sex chromosomal genotype no phenotypical differences between sexes are present during the early embryonic development of mammals. The first event of sexually dimorphic development is the differentiation of the bipotential gonad into testis or ovary. Barker theory of fetal programming: gender differences risk for later life diseases are laid down in the fetal phase (behavior)

7. Data of current studies clearly indicate that the sex-biased expression of genes is highly tissue-specific Are there tissue-specific sex-organizers? or Are there sex-specific tissue-organizers? 8. What are the consequences/use of this type of knowledge for society? Can sexual dimorphism of gene expression in brain be examined in humans? What would be the meaning of knowing that male and female brain-genes are differently expressed? Could we then better understand sex-dependent behavior?

CONCLUSIONS: GENOMICS IS A NEW TECHNOLOGY -Robustness -Reliability/validation -Handling of large datasets -Animal studies Expensive Descriptive Large scale quantification of molecular sex differences Continue and expand studies ??? -Human -Prenatal -Mechanistic -> ethical issues -> what will this lead to