Redox controlled biogeochemical processes affecting arsenic solubility down a sediment profile Xianyu Meng* and Joan E. McLean Abstract Arsenic concentration in groundwater throughout Cache County, Utah, exceeds the drinking water limit. Previous studies of aquifer solids collected from an area near the Logan landfill revealed that the As in the groundwater is from geologic sources. In order to determine the geologic sources of As and to explore the driving force(s) for As release/retention that controls the spatial variability in As levels in the groundwater, core samples, consisting of vadose zone, redox transition zone and saturated zone solids, from the soil surface to the depth of groundwater, were collected from the same area. Geologic As was not confined to the deep aquifer solids but was also in the surficial materials. Primary As minerals may be continuously deposited potentially via weathering of volcanic rock from the Salt Lake Formation located along the base of the Wellsville Mountains or leaching of As-containing minerals from the Bear River Range. In the redox transition zone, arsenic was sorbed or co-precipitated with Fe oxides and carbonate minerals. DNA extraction and analyses indicated that dissimilatory As reducing bacteria (DARB) and As oxidizing bacteria were present. Reductive dissolution of Fe oxides works in conjunction with direct microbial As reduction thereby causing solubilization of As. Arsenic content reached its maximal value in the saturation zone. The accumulation in this zone may be due to the retention of As by reformed Fe-sulfides under sulfate-reducing conditions. Understanding the behavior of geologic As in this location is important because these processes may also affect other regions in northern Utah due to similarity in the geology. Sample handling  Cores were sectioned into vadose zone, redox transition zone, and saturated zone based on redoximorphic features;  Cores were further sectioned into layers based on solids characteristics (color, texture, etc.);  Vadose zone solids were air-dried, while all other core materials were stored under anaerobic conditions. Arsenic characterization  Nitric acid digestion was used to determine total As in the solid phase (USEPA 3050 Method);  An 0.5 M HCl extraction was used to determine the oxidation state of acid soluble Fe and As minerals. Identification of volcanic glass and pyrite Core materials collected at NP9 were sieved for very fine sand (VFS) and fine sand (FS) fractions then examined for volcanic glass and pyrite using an Olympus BH-2 petrographic microscope (Olympus Optical Co., Ltd.). Identification of DARB and As oxidizing bacteria DNA extraction and PCR amplification were performed on the surficial materials collected at NP9 to detect:  DARB: indicated by arrA genes;  Arsenic oxidizing bacteria: indicated by aoxA genes. Discussions: Conceptual model  Zone I: Primary and secondary As minerals are continuously deposited via the weathering of the Salt Lake Formation. The oxidative dissolution leads to leaching of As(V) from the surface layers;  Zone II: The released As from Zone I is adsorbed to Fe oxides and carbonate minerals. As the groundwater fluctuates, arsenic is released through microbial reductive dissolution of Fe oxides (Meng et al, 2010);  Zone III: Sulfide precipitates with Fe to form sulfide minerals that sequester As;  Zone IV: Not sampled;  Zone V: Arsenic in this zone is either incorporated in sulfides or associated with Fe minerals. Two processes may control As solubilization in this zone: 1. microbial reductive dissolution of Fe oxides causes As release; 2. precipitate of acid insoluble As minerals (Meng et al, 2010). Introduction The As concentration in 22 of 172 groundwater samples collected throughout Cache County exceeded the EPA’s regulation for As in drinking water, 10 µg/L. Most research efforts have dealt with deep subsurface material in humid regions of the world. In many of these locations, the source of As was attributed to the dissolution of As-bearing Fe oxides. In arid and semi-arid regions, however, the source of As and the dominant mechanisms of As release to groundwater may differ from humid environments. Objectives  Determine the As mineralogy down a profile from the soil surface to depth of groundwater in the aquifer solids collected from an area with elevated As in groundwater;  Determine if the DARB and As oxidizing bacteria are present in the solids;  Determine if pyrite and volcanic glass are present in the surficial materials and aquifer solids. Methods Sampling Cores were collected at NP1, NP9, and NP13 which is near the Logan Landfill (Fig.1):  Surficial cores: from the ground surface to about 1.7 m;  Aquifer cores: ranged from m below ground surface. References  Meng, X., Muruganandam, S., McLean, J.E., Mobilization of geologic arsenic in the aquifers of Cache Valley, Northern Utah. Annual meetings of the Soil Soc. Am. Long Beach, CA, November.  Song, B., Chyun, E., Jaffe, P.R., Ward, B.B., Molecular methods to detect and monitor dissimilatory arsenate-respiring bacteria (DARB) in sediments. Fems Microbiology Ecology 68,  Morais, P.V., Branco, R., Francisco, R., Chung, A.P., Identification of an aox System That Requires Cytochrome c in the Highly Arsenic-Resistant Bacterium Ochrobactrum tritici SCII24. Applied and Environmental Microbiology 75, *Contact information: (435) Acknowledgements Utah Water Research Laboratory, Utah State University Department of Plant, Soil and Climate for sample collection Figure 3. Conceptual model of arsenic solubilization controlled by biogeochemical processes. Results Arsenic profile Total As content ranged from 2,000 µg/kg to 18,000 µg/kg. Although there were differences among cores, a similar trend, as illustrated for NP9 (Fig. 2), was observed:  Zone I: More than 65% of the total As, mostly as As(V), was extractable with HCl (dissolution of carbonate and some oxides);  Zone II: 90% of the As was associated with carbonate and oxide minerals extractable with HCl;  Zone III: A decrease in the proportion of HCl extractable As was accompanied by an increase in As(III) and an accumulation of total As;  Zone IV: Not sampled;  Zone V: Total As fluctuated, but the HCl extractable As was always less than 40%. Figure 2. Arsenic profile at NP9. Zone I Zone II Zone III Zone IV Zone V Weathering effect/ Microbial activity Sulfides Primary As minerals Secondary As minerals Zone I Zone II Zone III Zone IV Zone V Secondary As minerals Fe oxides/ Carbonate minerals Sulfide 1 2 Table 1. The primers used to amplify the arrA genes and aoxA genes GenePrimer IDTarget sequence (5’-3’)Reference arrA AS1F CGAAGTTCGTCCCGATHACNTGGSong et al., 2009 AS1R GGGGTGCGGTCYTTNARYTC AS2F GTCCCNATBASNTGGGANRARGCNMT AS2R ATANGCCCARTGNCCYTGNG aoxA aoxAF TCCGTTGAGCTATTCGGCGGAMorais et al., 2009 aoxBR1 AGCTTGTCGGCTGCATCTGGCC aoxBF ATCGTTTGGCAATCTGCCTTTC aoxBR2 TCCGTATAGAGACGCTGGGTG Volcanic glass and pyrite  The occurrence of volcanic glass in the surficial materials was negligable, whereas volcanic glass accounted for approximately 25% of the total VFS and FS in the aquifer solids;  Pyrite-like minerals, up to 10% of the total, was found in the surficial materials, while in the aquifer solids the amount of pyrite-like minerals decreased to 1~2%. DARB and As oxidizing bacteria in surficial materials  ArrA genes were identified in Zone I, Zone II, and Zone III;  AoxA genes were identified in Zone I and Zone II. Figure 1. Locations of the sampling sites (yellow pinhead indicate monitoring well; red circle indicate the location where the core was collected). Logan Landfill N 200 N 1400 W