Go to Section: which crosses consists of Selective Breeding for example Inbreeding Hybridization Similar organisms Dissimilar organisms for example Organism breed A Organism breed B Retains desired characteristics Combines desired characteristics which which crosses which Section 13-1 Concept Map

Go to Section: The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces? Section 13-2 Interest Grabber

Go to Section: 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Section 13-2 Interest Grabber continued

Go to Section: 13–2Manipulating DNA A.The Tools of Molecular Biology 1.DNA Extraction 2.Cutting DNA 3.Separating DNA B.Using the DNA Sequence 1.Reading the Sequence 2.Cutting and Pasting 3.Making Copies Section 13-2 Section Outline

Go to Section: Recognition sequences DNA sequence Section 13-2 Restriction Enzymes

Go to Section: Recognition sequences DNA sequence Restriction enzyme EcoR I cuts the DNA into fragments. Sticky end Section 13-2 Restriction Enzymes

Go to Section: DNA plus restriction enzyme Mixture of DNA fragments Gel Power source Longer fragments Shorter fragments Section 13-2 Figure 13-6 Gel Electrophoresis

Go to Section: Section 13-2 Figure 13-7 DNA Sequencing

Go to Section: DNA polymerase adds complementary strand DNA heated to separate strands DNA fragment to be copied PCR cycles 1 DNA copies etc. 16 etc. Section 13-2 Figure 13-8 PCR

Go to Section: Sneaking In You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer. Section 13-3 Interest Grabber

Go to Section: 1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory? 2.Why would a person download a virus program? 3.If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA? Section 13-3 Interest Grabber continued

Go to Section: 13–3Cell Transformation A.Transforming Bacteria B.Transforming Plant Cells C.Transforming Animal Cells Section 13-3 Section Outline

Go to Section: Recombinant DNA Flanking sequences match host Host Cell DNA Target gene Recombinant DNA replaces target gene Modified Host Cell DNA Section 13-3 Knockout Genes

Go to Section: Human Cell Gene for human growth hormone Recombinant DNA Gene for human growth hormone Sticky ends DNA recombination DNA insertion Bacterial Cell Plasmid Bacterial chromosome Bacterial cell for containing gene for human growth hormone Section 13-3 Figure 13-9 Making Recombinant DNA

Go to Section: Recombinant plasmid Gene to be transferred Agrobacterium tumefaciens Cellular DNA Transformed bacteria introduce plasmids into plant cells Plant cell colonies Complete plant is generated from transformed cell Inside plant cell, Agrobacterium inserts part of its DNA into host cell chromosome Section 13-3 Figure Plant Cell Transformation

Go to Section: The Good With the Bad The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey. Section 13-4 Interest Grabber

Go to Section: 1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? 2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild? Section 13-4 Interest Grabber continued

Go to Section: 13–4Applications of Genetic Engineering A.Transgenic Organisms 1.Transgenic Microorganisms 2.Transgenic Animals 3.Transgenic Plants B.Cloning Section 13-4 Section Outline

Go to Section: Cloning Section 13-4 Flowchart A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The fused cell begins dividing, becoming an embryo. The nucleus is removed from the egg. The body cell and egg are fused by electric shock. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal.

Go to Section: A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an electric shock. Fused Cell The fused cell begins dividing normally. Embryo The embryo is placed in the uterus of a foster mother. Foster Mother The embryo develops normally into a lamb—Dolly Cloned Lamb Egg Cell An egg cell is taken from an adult female sheep. The nucleus of the egg cell is removed. Section 13-4 Figure Cloning of the First Mammal

Video Click the image to play the video segment. Gene Transfer

End of Custom Shows This slide is intentionally blank.