AMINO ACID tRNA ANTICODON  CODON  mRNA

Everything in you is made of or by proteins! Protein Examples Hemoglobin is a protein in your blood that transports oxygen Collagen is a proteins that makes your cartilage and tendons Keratin is a protein that makes up your hair & fingernails Enzymes that break down your food are proteins Everything in you is made of or by proteins!

DNA is like a code that instructs the cell to make proteins A gene is a sequence of DNA that carries the code for making one protein

DNA – Deoxyribonucleic acid RNA – Ribonucleic Acid Nitrogen Bases Sugars & Phosphates RNA DNA RNA is like DNA except… DNA – Deoxyribonucleic acid RNA – Ribonucleic Acid * 2 strands vs. 1 strand * Thymine vs. Uracil (others are the same) * Deoxyribose vs. Ribose * Nucleus vs. Cytoplasm

Types of RNA mRNA – “messenger” RNA tRNA – “transfer” RNA - Carries copies of instructions from DNA for making amino acids into proteins tRNA – “transfer” RNA - Transfers each amino acid to the ribosome as specified by the code on mRNA rRNA – “ribosomal” RNA - Makes up part of the ribosome, where proteins are made

2 parts of protein synthesis: Both DNA and RNA are involved in protein synthesis 2 parts of protein synthesis: Transcription – DNA is converted to RNA Occurs in the nucleus Translation – RNA is converted to a protein - Occurs in the cytoplasm

Protein Synthesis Transcription (the 1st part of Protein Synthesis) Converts DNA to RNA DNA (in the nucleus) needs to send a code to the ribosome (in the cytoplasm) Problem: DNA can’t fit through the nuclear pores A special “messenger” is used to copy and carry the code… Ribosome

Protein Synthesis Transcription Cont’d messenger RNA (mRNA) goes into the nucleus and copies the DNA Uses enzyme – RNA Polymerase DNA AGGTATCGCAGATCGACAGATC RNA UCCAUAGCGUCUAGCUGUCUAG The next step is that mRNA moves from the nucleus to the cytoplasm and to the ribosome

p367

Translation (2nd part of protein synthesis) Amino acids – building blocks of proteins, carried to ribosomes by ______________ Polypeptides – long chains of ____________ Codon – group of ____ nucleotide bases in mRNA which carries code for making _______________________ Ex: Anticodon – group of _____ nucleotide bases in tRNA which is complementary to one ___________________ tRNA Amino Acids 3 ONE amino acid AUG - Methionine 3 codon

Translation Cont’d ____________ attaches to the ribosome ____________ carries amino acids to the ribosome and matches them to the coded mRNA message (codon) Amino acids bond together, forming a long chain called a ____________________ Finally, polypeptides fold into various types of proteins and there you have it! mRNA tRNA Polypeptide chain

Translation (the 2nd part of Protein Synthesis) Translation – a process that converts mRNA into a protein Occurs on the ribosome in the cytoplasm of a cell ______________ - building blocks of proteins; join together into long chains called polypeptides ____________ - a sequence of 3 bases on mRNA that codes for a single amino acid _____________ – sequence of 3 bases on tRNA that is complementary to one mRNA codon Amino acids Codon Anticodon “UCU” is the codon that makes an amino acid called SERINE

The tRNA lines up with 3 bases in mRNA (codon) tRNA anticodon GAA mRNA codon CUU Another form of RNA called transfer RNA (tRNA) carries amino acids to the ribosome and matches them to the coded mRNA message tRNA drops off the amino acid in the correct spot mRNA attaches to the ribosome

AMINO ACID tRNA ANTICODON  CODON  mRNA

Mutations Any change in the DNA structure (specifically the order of nitrogen bases) is a mutation. Mutations can be helpful, harmful, or neutral. Helpful – can create diversity in a population Harmful – can cause things like cancer Neutral – can have absolutely no effect at all A mutagen is something that causes mutations in the DNA (for example: smoking, radiation from the sun etc) Slooze Worm

Mutations An insertion mutation is when a nitrogen base is added to the existing DNA A deletion mutation is when a nitrogen base is subtracted from the DNA A substitution mutation is when one nitrogen base is put in place of another. If our DNA was AATTGGCC An insertion would be AATTAGGCC A deletion would be AATGGCC A substitution would be AAATGGCC

Gene Sequencing – Determining the order of nucleotide bases within a gene DNA Fingerprinting – technique used in criminal investigations. DNA Fingerprinting takes the DNA out of a cell and separates it. This will allow investigators to distinguish body cells of different individuals (since they are unlikely to have the same DNA) Cloning – take the DNA out of one of your cells then take the DNA out of a zygote (fertilized egg). Put the DNA from your cell into the zygote.

Genetic engineering is the process of moving genes from the chromosomes of one organism to those of another organism. Recombinant DNA is formed by joining DNA molecules.from two different organisms Animation

What would represent the strand of DNA from which the mRNA strand in the diagram was made? A.CUCAAGUGCUUCB.GAGUUCACGAAG C.GAGTTCACGAAGD.AGACCTGTAGGA What is the amino acid sequence in the portion of the protein molecule coded for by the piece of mRNA shown in the diagram? A. Ser-Tyr-Arg-GlyB.Leu-Lys-Cys-PheC.Val-Asp-Pro-HisD.Pro-Glu-Leu-Val