Visualization of genomic data Genome browsers. UCSC browser Ensembl browser Others ? Survey.

Slides:

Advertisements

Similar presentations

© Wiley Publishing All Rights Reserved. Using Nucleotide Sequence Databases.

Advertisements

Peter Tsai, Bioinformatics Institute.  University of California, Santa Cruz (UCSC)  A rapid and reliable display of any requested portion of genomes.

1 Computational Molecular Biology MPI for Molecular Genetics DNA sequence analysis Gene prediction Gene prediction methods Gene indices Mapping cDNA on.

Psi-BLAST, Prosite, UCSC Genome Browser Lecture 3.

Tutorial 7 Genome browser. Free, open source, on-line broswer for genomes Contains ~100 genomes, from nematodes to human. Many tools that can be used.

Predicting the Function of Single Nucleotide Polymorphisms Corey Harada Advisor: Eleazar Eskin.

Genome Browsers Carsten O. Daub Omics Science Center RIKEN, Japan May 2008.

InterPro/prosite UCSC Genome Browser Exercise 3. Turning information into knowledge  The outcome of a sequencing project is masses of raw data  The.

1 Gene Finding Charles Yan. 2 Gene Finding Genomes of many organisms have been sequenced. We need to translate the raw sequences into knowledge. Where.

Copyright OpenHelix. No use or reproduction without express written consent1 Organization of genomic data… Genome backbone: base position number sequence.

Visualization of genomic data Genome browsers. How many have used a genome browser ? UCSC browser ? Ensembl browser ? Others ? survey.

UCSC Genome Browser Tutorial

Genome Browsers Ensembl (EBI, UK) and UCSC (Santa Cruz, California)

Bootcamp: Data Resources1 Paul Bain Reference and Education Services Librarian Countway Library of Medicine Countway.

Genomic Database - Ensembl Ka-Lok Ng Department of Bioinformatics Asia University.

Gene Discovery & Genome Browsing

How to access genomic information using Ensembl August 2005.

SNP Resources: Finding SNPs Databases and Data Extraction Mark J. Rieder, PhD Robert J. Livingston, PhD NIEHS Variation Workshop January 30-31, 2005.

Genome Browsing with the UCSC Genome Browser

UCSC Archaeal genome browser September 19, 2006 David Bernick, Aaron Cozen and Todd Lowe September 19, 2006 David Bernick, Aaron Cozen and Todd Lowe.

Genome Browsers UCSC (Santa Cruz, California) and Ensembl (EBI, UK)

Sequence Analysis. Today How to retrieve a DNA sequence? How to search for other related DNA sequences? How to search for its protein sequence? How to.

Visualization of genomic data Genome browsers. UCSC browser Ensembl browser Others ? Survey.

SNP Resources: Finding SNPs Databases and Data Extraction Mark J. Rieder, PhD SeattleSNPs Variation Workshop March 20-21, 2006.

Data retrieval BioMart Data sets on ftp site MySQL queries of databases Perl API access to databases Export View.

Doug Brutlag 2011 Genome Databases Doug Brutlag Professor Emeritus of Biochemistry & Medicine Stanford University School of Medicine Genomics, Bioinformatics.

A Gentle Introduction to UCSC Genome Browser 陳任志, 游岳齊.

The Genome Genome Browser Training Materials developed by: Warren C. Lathe, Ph.D. and Mary Mangan, Ph.D. Part 1.

What is comparative genomics? Analyzing & comparing genetic material from different species to study evolution, gene function, and inherited disease Understand.

The UCSC Genome Browser Introduction

Copyright OpenHelix. No use or reproduction without express written consent 2 Overview of Genome Browsers Materials prepared by Warren C. Lathe, Ph.D.

UCSC Genome Browser 1. The Progress 2 Database and Tool Explosion : 230 databases and tools 1996 : first annual compilation of databases and tools.

Copyright OpenHelix. No use or reproduction without express written consent1.

Genomics and Personalized Care in Health Systems Lecture 5 Genome Browser Leming Zhou, PhD School of Health and Rehabilitation Sciences Department of Health.

Browsing the Genome Using Genome Browsers to Visualize and Mine Data.

Sackler Medical School

数据库使用杨建华 2010/9/28. Outline of the Topics UCSC and Ensembl Genome Browser (Blat vs Blast vs Blastz vs Multiz) 挖掘数据用 Table Browser 或 BioMart 用户友好化你的数据.

Bioinformatics and Computational Biology

Tools in Bioinformatics Genome Browsers. Retrieving genomic information Previous lesson(s): annotation-based perspective of search/data Today: genomic-based.

How can we find genes? Search for them Look them up.

Annotation of Drosophila virilis Chris Shaffer GEP workshop, 2006.

Copyright OpenHelix. No use or reproduction without express written consent1.

Copyright OpenHelix. No use or reproduction without express written consent1.

Bioinformatics Workshops 1 & 2 1. use of public database/search sites - range of data and access methods - interpretation of search results - understanding.

Copyright OpenHelix. No use or reproduction without express written consent1.

UCSC Genome Browser Zeevik Melamed & Dror Hollander Gil Ast Lab Sackler Medical School.

Tools in Bioinformatics Genome Browsers. Retrieving genomic information Previous lesson(s): annotation-based perspective of search/data Today: genomic-based.

Accessing and visualizing genomics data

Genomes at NCBI. Database and Tool Explosion : 230 databases and tools 1996 : first annual compilation of databases and tools lists 57 databases.

Welcome to the combined BLAST and Genome Browser Tutorial.

Visualization of genomic data Genome browsers. How many have used a genome browser ? UCSC browser ? Ensembl browser ? Others ? survey.

Visualization of genomic data Genome browsers. UCSC browser Ensembl browser Others ? Survey.

Introduction to Bioinformatics Summary Thomas Nordahl Petersen.

Using public resources to understand associations Dr Luke Jostins Wellcome Trust Advanced Courses; Genomic Epidemiology in Africa, 21 st – 26 th June 2015.

BLAST: Basic Local Alignment Search Tool Robert (R.J.) Sperazza BLAST is a software used to analyze genetic information It can identify existing genes.

Web Databases for Drosophila

Basics of Comparative Genomics

GEP Annotation Workflow

Visualization of genomic data

Visualization of genomic data

From: TopHat: discovering splice junctions with RNA-Seq

Genome Editing with Apollo

Ensembl Genome Repository.

BLAT Blast Like Alignment Tool

Gene Safari (Biological Databases)

Problems from last section

Introduction to Alternative Splicing and my research report

Part II SeqViewer AraCyc Help

Determine CDS Coordinates

Presentation transcript:

Visualization of genomic data Genome browsers

UCSC browser Ensembl browser Others ? Survey

UCSC genome browser Basic functionalities Finding a gene by name by sequence Gene structure Orthologues – i.e. functional homolog in other organisms SNP’s - Single Nucleotide Polymorphisms Several other functionalities Gene Sorter - sort according to expression, homology, in situ images of genes in different tissues Custom tracks – upload your own data

UCSC genome browser Easy to use Often updates, but not as often as Ensembl upload of personal tracks Ensembl browser Less easy to use Maintained/updated by several people Gbrowser Genome browsers

Visualization of genomic data Genome browsers

Genome browsers Visualization of a gene >sequence ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGC GTCCGCCTTCCCGCTGCCCGCCGGTAAGAGGCCTCCCGAGGCGCCCGCCG AAGACCGCTCCCTCGGCCGCCGCCGCGCGCCCTTCGCGCTGAGCAGTGAC TGTAAGAACCGTTCCCTCCCCGCGGGGGGGCCGCCGGCGGACCCCCTCGC ACCCCCACCCGCAGCCAGCCCCGCACGTACCCCAAGCCAGCCTGATGGCT GTGTGGCCTACCGACCCGTGGGCAAGGGGTGCGGGTGCTGAAGCCCCCAG GGGTGCCTGGCTGCCCACTGCTGCCCGCACGCCTGGCCTGAAAGTGACAC GCGCTGGTTTGCCCAGCACAGAGGGGATGGAATTTTTATGCTGCTCCTTT AGCATTCTGATGAACAAATATCCTCCCCACCAGCACCACCACCTCAGAAA Chr Flat files / tab files Exon Intron

Genome browsers Visualization of a gene (Ensembl)

Genome browsers Visualization of a gene (UCSC) Exon Intron UTR Header

Genome browsers

BLAT genome Browser

BLAT genome Browser Using a search term or position eg Chr1:10,234-11,567

BLAT genome Browser

BLAT genome Browser Using a protein or DNA sequence

BLAT Blast Like Alignment Tool BLAT (2002) Very fast searches (MySQL database) Handle introns in genomic alignments Data for more that 30 genomes (human, mouse, rat…) Exon Intron Exon Splice sites

Blat genome Browser

BLAT genome Browser ”Details” Correct splice site ?

Splice sites

BLAT genome Browser ”Details” Correct splice site ?

BLAT genome Browser ”Details” Donor site | Acceptor site exon.... G | GT...intron...AG | exon...

Blat genome Browser

BLAT genome Browser ”Browser” Base, Center & Zoom Known genes Predictions RNA EST Conservation Expression

BLAT genome Browser Center & zoom

Forward/reverse direction Selected number of tracks

BLAT genome Browser Sequence Orthologs

“klick”

BLAT genome Browser Sequence Orthologs

SNPs

Gene Sorter

Gene Sorter - homology Closest homologues

Custom tracks Upload your personal data Share data with colleagues Data need to be related to a reference organism

Custom tracks

Exercise 1.Basic understanding of the graphics 2.Effect of Single Nucleotide Polymorphisms (SNPs) 3.Finding Orthologue genes