DNA Synthesis

Last time: n DNA is the chemical substance that serves as the genetic material (exception: RNA in some viruses) n Today: In order to pass on genetic material from parent (cell) to offspring (cell), the genetic material must be duplicated: DNA replication One chromosome (Unreplicated state) One chromosome (Replicated state) Centromere Sister chromatids DNA replication

Cell free in vitro DNA synthesis reactions were used to identify the enzymes involved in DNA replication. n DNA replication requires : Enzymes DNA polymerase I: 1st enzyme to be identified-adds DNA nucleotides to a 3’ end DNA polymerase III: main enzyme involved in DNA synthesis -adds DNA nucleotides to a 3’ end,can take away nucleotides at a 5’ end Primase, helicase, topisomerase, DNA ligase DNA replication requires a DNA template.

3' 5' 3' 5' Completely single stranded Completely double stranded Single strand as template plus 3' end to start synthesis 5' 3' 5' OH 3' GAATCTGC GAATCTGC CTTAGACG GAATCTGC CTT Polymerase inactive Polymerase active DNA polymerases can only add to the 3’ of a growing DNA strand

Figure Priming DNA synthesis with RNA III I DNA ligase seals pieces together

Cell free in vitro DNA synthesis reactions were used to identify the enzymes involved in DNA replication. n Characteristics of replication in vitro in E. coli: The new strands are initiated by adding nucleotides to a short RNA primer. At the replication fork, DNA polymerase III builds the new strands in the 5’-3’ direction. New nucleotides are only added to 3’ hydroxyl groups of other nucleotides.

DNA polymerase III Newly synthesized leading strand 3' 5' Replication fork 3' 5' Formation of the leading strand DNA polymerase III adds DNA nucleotides to the 3’end of a growing DNA strand RNA primer

One strand is formed continuously (leading strand); the other strand is formed in pieces (lagging strand) 3' 5' 3' 5' 3' 5' 3' 5' Lagging strands DNA polymerase III DNA polymerase III beginning synthesis of new fragment 3' 5' 3' 5' Okazaki fragments Gap RNA primer

Topoisomerase nicks DNA to relieve tension from unwinding Pol III synthesizes leading strand Helicase opens helix Primase synthesizes RNA primer Pol III elongates primer; produces Okazaki fragment Pol I excises RNA primer; fills gap DNA ligase links Okazaki fragments to form continuous strand DNA replication is semi-discontinuous

Figure The main proteins of DNA replication and their functions III I

Cell free in vitro DNA synthesis reactions were used to identify the enzymes involved in DNA replication. n Characteristics of replication in vitro in E. coli: The leading strand is the new growing strand that follows the replication fork. The lagging strand grows in the direction away from the replication fork and is synthesized in short pieces called Okazaki fragments, each with their own primer. Different enzymes catalyze each step of the process.

DNA replication is bidirectional

Figure Origins of replication in eukaryotes

Laboratory Analysis of DNA Sequences n PCR uses the mechanism of DNA replication to allow scientists to produce many copies of a DNA fragment in vitro. n Small DNA samples (I.e., blood drops at a crime scene) can be amplified and analyzed

CCCCATGCTTACAAGCAAGT Primer 5' 3' Primer Region of DNA to be amplified by PCR 5' 3' ATCCTATGGTTGTTTGGATGGGTG Primers are required to run PCR

3'5' 5'3' 3'5' 3' 5'3' 5' 3' 5' POLYMERASE CHAIN REACTION 1. Start with a solution containing template DNA, synthesized primers, and an abundant supply of the four dNTPs. 2. Denaturation Heating leads to denaturation of the double-stranded DNA. 3. Primer binding At cooler temperatures, the primers anneal to the template DNA by complementary base pairing.

5'5'3' 3'5' 5'3' 3'5' 4. Extension During incubation, DNA polymerase synthesizes complementary DNA strand starting at the primer. 5. Repeat cycle of three steps (2-4) again, doubling the copies of DNA. 6. Repeat cycle again, up to times, to produce millions of copies of template DNA.