Promoter Panel Review. Background related Promoter In genetics, a promoter is a DNA sequence that enables a gene to be transcribed. It may be very long.

Slides:

Advertisements

Similar presentations

PREDetector : Prokaryotic Regulatory Element Detector Samuel Hiard 1, Sébastien Rigali 2, Séverine Colson 2, Raphaël Marée 1 and Louis Wehenkel 1 1 Bioinformatics.

Advertisements

AHM 2002 Tutorial on Scientific Data Mediation Example 1.

Computational discovery of gene modules and regulatory networks Ziv Bar-Joseph et al (2003) Presented By: Dan Baluta.

Predicting Enhancers in Co-Expressed Genes Harshit Maheshwari Prabhat Pandey.

Computational detection of cis-regulatory modules Stein Aerts, Peter Van Loo, Ger Thijs, Yves Moreau and Bart De Moor Katholieke Universiteit Leuven, Belgium.

Finding regulatory modules from local alignment - Department of Computer Science & Helsinki Institute of Information Technology HIIT University of Helsinki.

Gapped Blast and PSI BLAST Basic Local Alignment Search Tool ~Sean Boyle Basic Local Alignment Search Tool ~Sean Boyle.

MICHAEL MORRA CSE 4939W Detection of Transcription Factor Binding Sites.

Regulatory Motifs. Contents Biology of regulatory motifs Experimental discovery Computational discovery PSSM MEME.

Genome-wide prediction and characterization of interactions between transcription factors in S. cerevisiae Speaker: Chunhui Cai.

A Very Basic Gibbs Sampler for Motif Detection Frances Tong July 28, 2004 Southern California Bioinformatics Summer Institute.

Tutorial 5 Motif discovery.

Introduction to Bioinformatics - Tutorial no. 5 MEME – Discovering motifs in sequences MAST – Searching for motifs in databanks TRANSFAC – The Transcription.

Multiple sequence alignments and motif discovery Tutorial 5.

MOTIF ENRICHMENT ANALYSIS IN CO- EXPRESSED GENE SETS AND HIGH- THROUGHPUT SEQUENCE SETS Wyeth Wasserman Jan. 18, 2012 opossum.cisreg.ca/oPOSSUM3.

Similar Sequence Similar Function Charles Yan Spring 2006.

Exploring Protein Sequences Tutorial 5. Exploring Protein Sequences Multiple alignment –ClustalW Motif discovery –MEME –Jaspar.

ANOVA WTdZAP1 p < /6189 (31.42%)2264/6189 (36.58%) p < /6189 (24.67%)1445/6189 (23.35%) p < /6189 (13.90%)792/6189 (12.80%) p

Finding Regulatory Motifs in DNA Sequences

Cis-regultory module 10/24/07. TFs often work synergistically (Harbison 2004)

MICHAEL MORRA CSE 4939W Detection of Transcription Factor Binding Sites.

Whole genome alignments Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas

Motif finding: Lecture 1 CS 498 CXZ. From DNA to Protein: In words 1.DNA = nucleotide sequence Alphabet size = 4 (A,C,G,T) 2.DNA  mRNA (single stranded)

Searching for TFBSs with TRANSFAC - Hot topics in Bioinformatics.

MRNA protein DNA Activation Repression Translation Localization Stability Pol II 3’UTR Transcriptional and post-transcriptional regulation of gene expression.

A systems biology approach to the identification and analysis of transcriptional regulatory networks in osteocytes Angela K. Dean, Stephen E. Harris, Jianhua.

Guiding Motif Discovery by Iterative Pattern Refinement Zhiping Wang, Mehmet Dalkilic, Sun Kim School of Informatics, Indiana University.

Good solutions are advantageous Christophe Roos - MediCel ltd Similarity is a tool in understanding the information in a sequence.

Detecting binding sites for transcription factors by correlating sequence data with expression. Erik Aurell Adam Ameur Jakub Orzechowski Westholm in collaboration.

Proliferation cluster (G12) Figure S1 A The proliferation cluster is a stable one. A dendrogram depicting results of cluster analysis of all varying genes.

Motif search Prof. William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington

Motif finding with Gibbs sampling CS 466 Saurabh Sinha.

Using Mixed Length Training Sequences in Transcription Factor Binding Site Detection Tools Nathan Snyder Carnegie Mellon University BioGrid REU 2009 University.

1 Supplemental Figure 1 Expression analysis of MPF1-like Withania duplicates The RNAs isolated from leaves, flower buds, sepals, stamens, carpels and siliques.

Motif discovery Tutorial 5. Motif discovery MEME Creates motif PSSM de-novo (unknown motif) MAST Searches for a PSSM in a DB TOMTOM Searches for a PSSM.

CS5263 Bioinformatics Lecture 20 Practical issues in motif finding Final project.

PreDetector : Prokaryotic Regulatory Element Detector Samuel Hiard 1, Sébastien Rigali 2, Séverine Colson 2, Raphaël Marée 1 and Louis Wehenkel 1 1 Department.

Computational Genomics and Proteomics Lecture 8 Motif Discovery C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E.

Sequence Comparison Algorithms Ellen Walker Bioinformatics Hiram College.

Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520

The TRANSFAC ® System comprises 7 databases: TRANSFAC ® Professional Suite TRANSFAC ® Professional Transcription factor database TRANSCompel ® Professional.

Comparative Genomics Gene Regulatory Networks (GRNs) Anil Jegga Biomedical Informatics Contact Information: Anil Jegga Biomedical Informatics Room # 232,

Starting Monday M Oct 29 –Back to BLAST and Orthology (readings posted) will focus on the BLAST algorithm, different types and applications of BLAST; in.

Regulatory Genomics Lab Saurabh Sinha Regulatory Genomics | Saurabh Sinha | PowerPoint by Casey Hanson.

Finding Patterns Gopalan Vivek Lee Teck Kwong Bernett.

Combining SELEX with quantitative assays to rapidly obtain accurate models of protein–DNA interactions Jiajian Liu and Gary D. Stormo Presented by Aliya.

How do we represent the position specific preference ? BID_MOUSE I A R H L A Q I G D E M BAD_MOUSE Y G R E L R R M S D E F BAK_MOUSE V G R Q L A L I G.

Genome annotation and search for homologs. Genome of the week Discuss the diversity and features of selected microbial genomes. Link to the paper describing.

Biocomputation: Comparative Genomics Tanya Talkar Lolly Kruse Colleen O’Rourke.

Local Multiple Sequence Alignment Sequence Motifs

Doug Raiford Lesson 5.  Dynamic programming methods  Needleman-Wunsch (global alignment)  Smith-Waterman (local alignment)  BLAST Fixed: best Linear:

. Finding Motifs in Promoter Regions Libi Hertzberg Or Zuk.

GENE EXPRESSION. Pretty Please Back doorBig Brother.

Special Topics in Genomics Motif Analysis. Sequence motif – a pattern of nucleotide or amino acid sequences GTATGTACTTACTATGGGTGGTCAACAAATCTATGTATGA TAACATGTGACTCCTATAACCTCTTTGGGTGGTACATGAA.

Intro to Probabilistic Models PSSMs Computational Genomics, Lecture 6b Partially based on slides by Metsada Pasmanik-Chor.

Introduction to Bioinformatics II

Introduction to Bioinformatics - Tutorial no. 5 MEME – Discovering motifs in sequences MAST – Searching for motifs in databanks TRANSFAC – the Transcription.

Pattern Discovery and Recognition for Understanding Genetic Regulation Timothy L. Bailey Institute for Molecular Bioscience University of Queensland.

Statistical Detection of Co-occurring Transcription Factor Binding Sites Armand Halbert 1.

Network Motifs See some examples of motifs and their functionality Discuss a study that showed how a miRNA also can be integrated into motifs Today’s plan.

 Software reliability is the probability that software will work properly in a specified environment and for a given amount of time. Using the following.

Your friend has a hobby of generating random bit strings, and finding patterns in them. One day she come to you, excited and says: I found the strangest.

BIOBASE Training TRANSFAC ® Containing data on eukaryotic transcription factors, their experimentally-proven binding sites, and regulated genes ExPlain™

Gene Regulation and Expression

A Very Basic Gibbs Sampler for Motif Detection

Babak Alipanahi1, Andrew Delong, Matthew T Weirauch & Brendan J Frey

De novo Motif Finding using ChIP-Seq

Finding regulatory modules

Transcription Protein Synthesis.

BIOBASE Training TRANSFAC® ExPlain™

Presentation transcript:

Promoter Panel Review

Background related Promoter In genetics, a promoter is a DNA sequence that enables a gene to be transcribed. It may be very long and may have multiple elements.geneticsDNAgenetranscribed In geWorkBench, Promoter Panel is used to discover potential transcription factor binding sites, based on known transcription factor binding profiles.

Background Cont’d Available Transcription factor binding profile databases:  Transfac: most complete but commercial, about 700 matrices  JASPAR: open source. Now it has 3 categories:  JASPAR CORE: 123 profiles  JASPAR PHYLOFACTS: 174 profiles  JASPAR FAM: familial profiles based on CORE. geWorkbench uses 108 matrices from an old versioned JASPAR CORE.

Background Cont’d For sequence AAAGTA: SCORE = 21/21* 21/21* 21/21 * 21/21 * 8/21 * 6/21 = 0.108

Algorithm Normalize the matrix, P(i) will be > 0. The formula for the score is very simple: = ΣlogP(i) Create a background sequence, two ways to create background sequence. Scan the background sequence to set up the threshold. For a length of 1K background sequence, you can get about Matrix.length scores. The threshold is based on the P-value. For example, for P-Value = The threshold is the lowest score for the top 5% scores. Scan the input sequence and report hits above the threshold. Report results In summary, The result is very stringent. Bonferroni Correction is used. P-Value is really PValue/1K. Best for detecting enrichment of some patterns.

Issues - Programmatic The algorithm is not very efficient. For every TF, one scan of the background and input sequence is required. Most of the time is spent on scanning background sequences. Do all tests on Protein sequences. Stop button doesn’t work. Different species. The 13K background sequence? Different programs use different background sequence. Module discovery is not correctly programmed? Too stringent for finding hits, good for checking enrichments. Miss “All Sequences” button. What can we do after we get the patterns? Save result do not work properly.

Issues - GUI  The logo is in poor quality. It should provide more information and should be in a separate panel.  Separate parameters and results.  The TFBS should be marked with direction, 5’ or 3’.  Use updated Sequence Panel.  No Image snapshot function.

Proposed fixes Update JASPAR Profiles Provide more information about the matrix. Use JASPAR Logos for JASPAR CORE, Use enoLogos instead of BioJava for user defined matrix to get high quality pictures. Scan once only. Get more information about 13K sequences. Cache the threshold for 13K. Change the GUI.