OEB 192 – 10.10.20 Tradeoffs, specialization & pleiotropy.

Slides:



Advertisements
Similar presentations
The Library is at 23 Queen Square The Library is at 23 Queen Square.
Advertisements

OEB 100 – Evolution in Action (OEB 100) Instructor: Christopher Marx Teaching fellow: Dipti Nayak Weekly meeting: NW B127 Time: Mondays 4 – 5:30.
CASE Facility in Palmer Hall By: Rosellen Petrillo.
Swim Lessons Fall 2008 Please call for private lessons or lessons for children with special needs. We will do our best to accommodate your requests and.
Thursday, October 20 4:00-8:00pm University of Colorado (room to be announced). Please register for this free workshop now at
OEB 192 – Tradeoffs, specialization & pleiotropy.
BIOS E-127– Evolution of pathogens (Grenfell et al., 2004)
BIOS E-127 – Evolution of digital organisms.
Miki Lee / OEB 192 – Mobile genetic elements and adaptive mutation.
OEB 192 – Evolution of pathogens (Grenfell et al., 2004)
OEB 192 – Mobile genetic elements and adaptive mutation.
OEB 192 – Mutation rate & population size II.
OEB 192 – Phenotypic diversity & epigenetics.
OEB 192 – Evolution of pathogens (Grenfell et al., Science)
BIOS E-127 – Pleiotropy & specialization.
OEB 192 – Phenotypic diversity & epigenetics.
OEB 192 – Phenotypic diversity & epigenetics.
An example story OEB (Nature 394:69-72)
Earth Sciences Contact: Dept Office The Department Office is open 9:00am until 5:00pm Monday - Friday.
More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.
OEB 192 – Optimality & evolution of networks.
BIOS E-127 – Prior theme music: “Evolutionary speculation.
OEB 192 – Mutation rate & population size I.
Evolution before Darwin Lamarck: Philosophie Zoologique (1809) OEB 192 – Prior theme music:
Genetic exchange in bacteria/archaea OEB 192 –
BIOS E-127 – Evolution of digital organisms.
BIOS E-127 – Evolution of microbes. An example story BIOS E-127 – (Nature 394:69-72)
OEB 192 – Epistasis. (Segrè et al., Nat. Genet.)
Saturday May 02 PST 4 PM. Saturday May 02 PST 10:00 PM.
BIOS E-127 – Diversification & co-evolution.
Experience Exeter – International Exchange and Study Abroad.
Experience Erasmus at University of Exeter. Your contacts at Exeter The Student Information Desk (SID), The Forum, Monday-Friday 8-8, Saturday 10-3 Your.
OEB 192 – Dynamics of adaptation. (Miki Lee, Nigel Delaney, Maryska Kaczmarek, Lewis Ward) In humidified, 30 °C room: 48-well plates Plate-shaking.
Flight Traveling By Emily. Surabaya – Auckland Departure time: Monday, September 29 th at 3:00 a.m. Length of flight: 9 hours and 16 minutes Auckland.
W ELCOME TO THE SURG E M EETING !! 9/21 Natural Sciences Career Design Center & Dr. Linnea Fletcher with Biotechnology.
Welcome Curriculum Night Mrs. Violet Grade 2. Welcome! While you are waiting. Please feel free to walk around the room and look at the sign-up sheets.
Is a community program to provide school supplies and backpacks for children in Wichita Falls.
Mission: Expand access to higher education opportunities for underserved populations in the Phoenix community by offering free, comprehensive college planning.
 SC235: Unit 1 Seminar Is it Biotic?. Course Overview  Term: Feb. 2 nd – April 12 th  Course site  Doc sharing  Webliography  Drop box  Communication:
Master of Science in Information Technology January Starters Welcome to The MSc. I.T. Course at Liverpool Hope University College.
Easter Revision Sessions Monday 14 April English Tuesday 15 April GCSE French 9.00 am – pm – Room 22 GCSE Photography am – 3.00 pm Wednesday.
 Smart Skills Week 11 Map 3. Monday What do the different colors represent on this map? World Population Distribution People Per Sq. Mile Per Nation.
HEPiX-HEPNT Fermi National Accelerator Lab October 23-25, 2002.
Mondays & Wednesdays 12-8 Tuesdays & Thursdays 10-6 Fridays & Saturdays 10-5 Walnut Street West Library News and Events
THE NMSU WRITING CENTER an orientation find us at towc.nmsu.edu.
MU Condominium 5,000 Baht per month Maximum number of people per room: 3 (4 in case of a family) 2-bedroom (both large and small rooms) 3,000 Baht per.
Chulabhorn Graduate Institute 2013 Welcome to CGI Learning Center.
Prep Writing Lab Orientation 12 Tips to Success! is the magic number!
Welcome to Our Virtual Tour. Student Lounge Second Floor.
Welcome to Our Virtual Tour. Student Lounge Second Floor.
Advising and Career Centers ASU 101. Advising Center Advising and Career Development  Career workshops  SCI Job Fairs  Employer information sessions.
Mondays & Wednesdays 12-8 Tuesdays & Thursdays 10-6 Fridays & Saturdays 10-5 Walnut Street West Library News and Events
Welcome Dr. Chavis (719) Before school: Science department offices 1st period: Room 256 PES 2nd period: Planning 3rd-4th.
OEB 192 – Dynamics of adaptation.
“I write entirely to find out what I’m thinking, what I’m looking at, what I see, and what it means.” –Joan Didion.
Community. festival unity CommUNITY Festival 2008.
An example story BIOL E-127 – 9/24/07 (Nature 394:69-72)
Engineers’ Council Meeting 9/22/15. Engineering Career Expo Second day is tomorrow 11:00 – 4:00 Confirmation for Program Sales volunteers will be sent.
Monday October 5, 2015 WARM-UP: QUESTION #1 WEEK OF OCT 5 QUESTION - DESCRIBE HOW THE RESPIRATORY SYSTEM AND THE CIRCULATORY SYSTEM WORK TOGETHER. Unit.
Welcome! Please Find Your Seat! Tuesday August 19, Dr. Chavis 2.Biology 3.1 st period: Room rd -7 th Period: Room Learning Target:
Merit Learning Center Session One 8:00 am – 11:00 pm Monday – Friday Accommodate 108 students in 3 labs Transportation Concord High School GHS Special.
My Plan to Go to Around the world By: Benedict/5C.
Further information about the speakers may be obtained from
The evolution of WCI for biological specificity makes organisms more evolvable. The evolution of WCI for biological specificity makes organisms more evolvable.
INSTITUTE FOR RECRUITMENT OF TEACHERS
Genome Science Theme Seminar
Global Warming Mitigation and the fifth assessment reports of IPCC
The Biological and Biomedical Joint Seminar Series
Neither Agree Nor Disagree
Presentation transcript:

OEB 192 – Tradeoffs, specialization & pleiotropy

(Barrick et al., Nature)

(Lee et al., Evolution)

(Travisano & Lenski, Science)(Giver et al., PNAS)

Monday (10/25): Mutation rate & population size I.

1. Program for Evolutionary Dynamics Yonatan (Yoni) Savir (Weizmann Institute of Science Israel): “Rubisco, the most abundant protein on Earth: An example for optimality of proteins.” when: 4:00 pm Thursday 21 st October 2010 where: 1 Brattle Square 6 th floor map: PED seminar series: for more information please contact: 2. Microbial Science Initiative Chalk Talk William Harcombe Harvard (Marx lab) “The evolution of social interactions in a model microbial community” Friday Oct. 22 8:45-9:30 AM Location: Center for the Environment (Rm 310) 24 Oxford St, Harvard University, Cambridge 3. FAS Center for Systems Biology Bauer Forum Claus Wilke (UT Austin) “Molecular evolution and disease” Friday Oct. 22 4:00 -5:00 pm NW Labs, room 425